Prev. |  KEGG KO K11594 > 

RIKEN DNA Bank Human Resource - DDX3X

Gene ID NCBI Gene 1654 |  KEGG hsa:1654
Gene Symbol DDX3X
Protein Name DEAD-box helicase 3 X-linked
Synonyms CAP-Rf|DBX|DDX14|DDX3|HLP2|MRX102
Ortholog resource in our bank

  DDX3X

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091267 IRAL028C19 pOTB7 BC011819 NM_001356 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099248 M01C048B24 pDONR221 MGC13-H12 BC011819 NM_001356  
HGE099296 M01C048D24 pDONR221 MGC13-H12 BC011819 NM_001356  
HGE099344 M01C048F24 pDONR221 MGC13-H12 BC011819 NM_001356  
HGE099392 M01C048H24 pDONR221 MGC13-H12 BC011819 NM_001356  
HGE099440 M01C048J24 pDONR221 MGC13-H12 BC011819 NM_001356  
HGE099488 M01C048L24 pDONR221 MGC13-H12 BC011819 NM_001356  
HGE099536 M01C048N24 pDONR221 MGC13-H12 BC011819 NM_001356  
HGE099584 M01C048P24 pDONR221 MGC13-H12 BC011819 NM_001356  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR277726 ARiS194F06 pGCAP10 NM_001356.3  
GAGAGCCNCANTTCTCCCGTGAGAGGGCCTTCGCGGTGGAACAAACACTCGCTTAGCAGC
HKR365378 RBd13H10 pGCAP10 NM_001356.3  
GAGAGCCGCAGTTCTCCCGTGAGAGGGCCTTCGCGGTGGAACAAACACTCGCTTAGCAGC
HKR372553 RBd31G09 pGCAP10 NM_001356.3  
GAGAGCCGCAGTTCTCCCGTGAGAGGGCCTTCGCGGTGGAACAAACACTCGCTTAGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl