Prev. |  KEGG KO K04452 > 

RIKEN DNA Bank Human Resource - DDIT3

Gene ID NCBI Gene 1649 |  KEGG hsa:1649
Gene Symbol DDIT3
Protein Name DNA damage inducible transcript 3
Synonyms AltDDIT3|C/EBPzeta|CEBPZ|CHOP|CHOP-10|CHOP10|GADD153
Featured content MAPK p38 inhibitor screening
Featured content Apoptosis - human
Ortholog resource in our bank

  DDIT3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06062 pCMFlag_hsDDIT3 Expression vector of human CHOP10.
RDB07436 pAxEFFlag__hsDDIT3it2 Shuttle vector to generate rAd harboring human DDIT3
RDB07445 pdxEFFlag_hsDDIT3it2 Plasmid clone of human CHOP10 cDNA

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084709 IRAL011M21 pOTB7 BC003637 NM_004083 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE035649 W01A089C01 pENTR-TOPO IRAL011M21 BC003637 NM_004083  
HGE035651 W01A089C03 pENTR-TOPO IRAL011M21 BC003637 NM_004083  
HGE035653 W01A089C05 pENTR-TOPO IRAL011M21 BC003637 NM_004083  
HGE035669 W01A089C21 pENTR-TOPO IRAL011M21 BC003637 NM_004083  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR179206 ARi48A06 pGCAP10 NM_004083.4  
GAGAGACTTAAGTCTAAGGCACTGAGCGTATCATGTTAAAGATGAGCGGGTGGCAGCGAC
HKR364523 RBd11F03 pGCAP10 NM_004083.4  
TGGGTCAGAGACTTAAGTCTAAGGCACTGAGCGTATCATGTTAAAGATGAGCGGGTGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl