DNA Bank Top |  KEGG KO K04402 > 

RIKEN DNA Bank Human Resource - GADD45A

Gene ID NCBI Gene 1647 |  KEGG hsa:1647
Gene Symbol GADD45A
Protein Name growth arrest and DNA damage inducible alpha
Synonyms DDIT1|GADD45
Featured content Apoptosis - human

Link

Ortholog resource in our bank

  GADD45A

External database

human GADD45A

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07320 pGL4-phGADD45A Promoter collection, Human GADD45A promoter    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090888 IRAL027D16 pOTB7 BC011757 NM_001924.4 full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE045351 W01A113G07 pENTR-TOPO IRAL027D16 BC011757 NM_001924 done
HGE045353 W01A113G09 pENTR-TOPO IRAL027D16 BC011757 NM_001924  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048031 ARe20B07 pKA1U5 NM_001924.2  
GAGTGGCTGGCTAGGCAGTGGCTGGGAGGCAGCNCGNNCNATTAGTGTCGTGCGGCCCGT
HKR174946 ARi37G02 pGCAP10 NM_001924.2  
GAGTGGCTGGTAGGCAGTGGCTGGGAGGCAGCGGCCCAATTAGTGTCGTGCGGCCCGTGG
HKR187682 ARi69D10 pGCAP10 NM_001924.2  
GGGAGAGCGGGGCCCTTTGTCCTCCAGTGGCTGGTAGGCAGTGGCTGGGAGGCAGCGGCC
HKR234195 ARiS085I03 pGCAP10 NM_001924.2  
GGGCTGGGAGGCAGCGGCCCAATTAGTGTCGTGCGGCCCGTGGCGAGGCGAGGTCCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl