Prev. |  KEGG KO K04648 > 

RIKEN DNA Bank Human Resource - DCTN1

Gene ID NCBI Gene 1639 |  KEGG hsa:1639
Gene Symbol DCTN1
Protein Name dynactin subunit 1
Synonyms DAP-150|DP-150|P135
Featured content Huntington disease - human
Ortholog resource in our bank

  DCTN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066878 IRAK167D06 pBluescriptR BC071583 NM_023019 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222283 ARiS055L19 pGCAP10 NM_004082.3  
GCGCCGGCCCCGCAGGGTCTTGGGCGTCGGTCNTCNGTGGGGTCGGAGCTGGNCGCGNAG
HKR444277 RBdS110L13 pGCAP10 NM_004082.3  
GGGGCGTCGGTCGTCGGTGGGGTCGGAGCTGGGCGCGGAGCCCCTCACAGTGCAGACGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl