RIKEN DNA Bank Human Resource - DCT
|
Ortholog resource in our bank DCT External database KEGG gene KEGG Ortholog NCBI Gene |
Individualy Deposited Resource
| Catalog number | Name of Resource | Description |
|---|---|---|
| RDB01621 | pHDT8 | Human DOPAchrome tautomerase/ tyrosinase-related protein 2, cDNA |
| RDB02316 | pAxCAhDCT (forward) | Shuttle vector to produce rAd expressing human DCT |
| RDB02317 | pAxCAhDCT (reverse) | Shuttle vector to produce rAd expressing human DCT |
| RDB02790 | AxCALNLhDCT (forward) | Recombinant adenovirus harboring human DOPAchrome tautomerase/tyrosinase-related protein 2 cDNA |
| RDB02827 | pAxCALNLhDCT (forward) | Shuttle vector to generate rAd expressing human DOPAchrome tautomerase/tyrosinase-related protein 2 |
| RDB03280 | pAxCALNLhDCT (forward) | Shuttle vector to generate rAd harboring human DOPA chrome tantomerase cDNA |
| RDB05492 | pKM2L-phDT | Promoter Bank clone, Human DOPAchrome tautomerase (DT,DCT/TRP-2,TYRP2) promoter |
webcatalog20220516.tab
NRCD Human cDNA Clone
Plasmid request [in Japanese] [in English]
| Catalog number | Clone name | Vector | CDS comparison | Status | |
|---|---|---|---|---|---|
| Refered mRNA(1) | CDS status | ||||
| 5'-terminal sequence(2) | |||||
| HKR452890 | RBdS132D18 | pGCAP10 | NM_001922.3 |  |
|
| TTTGGTGTGCACGTTCATGTACACATGTGCACACATGTAACCTCTGTGATTCTTGTGGGT | |||||
| HKR323205 | RBb08A05 | pKA1U5 | NM_001922.3 | ||
| GAAGGAAATTAAGTCTGTTAGTTGTTTGAATCACATAAAATTGTGTGTGCACGTTCATGT | |||||
| HKR327649 | RBb19C01 | pKA1U5 | NM_001922.3 | |
|
| GGACTGAAAGAGTAGAAGATAAGGAGAAAAGTACNACAGAGACAAGGAAAGTAAGAGAGA | |||||
| HKR339345 | RBb48G01 | pGCAP1 | NM_001922.3 | ||
| ACTGAGTTNAGGCAATTTAAAGTCAAGAGCTAAGGAGGGAGGGAGAGGGTTTAGAAATAC | |||||
♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.
NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv
2023.05.10
Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl