Prev. |  KEGG KO K09056 > 

RIKEN DNA Bank Human Resource - DBP

Gene ID NCBI Gene 1628 |  KEGG hsa:1628
Gene Symbol DBP
Protein Name D-box binding PAR bZIP transcription factor
Synonyms DABP|taxREB302
Ortholog resource in our bank

  DBP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03469 pAxCALNLhDbp (forward) Shuttle vector to generate rAd harboring human Dbp (forward)
RDB04058 pAxCALNLhDbp (reverse) Shuttle vector to generate rAd harboring human Dbp (reverse)
RDB04675 pAxCALNLhDbp(forward) Shuttle vector to generate rAd expressing human DBP
RDB05084 pAxCALNLhDbp(forward) Shuttle vector to generate rAd expressing human DBP
RDB05085 pAxCALNLhDbp(reverse) Shuttle vector to generate rAd expressing human DBP
RDB06259 pCMFlag_hsDBP Expression vector of human DBP.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008441 IRAK021B17 pCMV-SPORT6 BC011965 NM_001352

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041841 W01A104K01 pENTR-TOPO IRAK021B17 BC011965 NM_001352  
HGE041847 W01A104K07 pENTR-TOPO IRAK021B17 BC011965 NM_001352  
HGE041849 W01A104K09 pENTR-TOPO IRAK021B17 BC011965 NM_001352  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234996 ARiS087I04 pGCAP10 NM_001352.3  
GGCACACCTCTCGGTGCAGATTGCAAAGCGCCTTCCGTTGCGAGAGCTGCAGATTTTGCA
HKR332405 RBb31A05 pGCAP1 NM_001352.3  
GGCACACCTCTCGGTGCAGATTGCAAAGCGCCTTCCGTTGCGAGAGCTGCAGATTTTGCA
HKR347255 RBb68C07 pGCAP1 NM_001352.3  
AGGAGGCGTCAGCACGTGACTCGGCCCTGAACCTGTGTCCTTAGCTGGCCCCGGCTGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl