Prev. | 

RIKEN DNA Bank Human Resource - DBN1

Gene ID NCBI Gene 1627 |  KEGG hsa:1627
Gene Symbol DBN1
Protein Name drebrin 1
Synonyms D0S117E
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082742 IRAL006O06 pOTB7 BC000283 NM_004395 Full/var
HGY088943 IRAL022F23 pOTB7 BC007567 NM_004395 Full/var
HGY089049 IRAL022K09 pOTB7 BC007281 NM_004395 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042578 ARe06H10 pKA1U5 NM_004395.3  
GGCCGGGCCGGGGCGGCGCTAGGACCGAGCGAGCGGAGGGAGCGAGCCGGGCGGAGCCAGC
HKR079211 ARe98A11 pKA1U5 NM_004395.3  
GGCAGAGGCTCCGAGGCGGCGGCGGCGACTCCCTCTTTCCCTCCCTCCTCCTCCGTCCGC
HKR219944 ARiS049O08 pGCAP10 NM_004395.3  
TGAGAGGCTCCGAGGCGGCGGCGGCGACTCCCTCTTTCCCTCCCTCCTCCTCCGTCCGCC
HKR392809 RBd82A09 pGCAP10 NM_004395.3  
GAGAGGCTCCGAGGCGGCGGCGGCGACTCCCTCTTTCCCTCCCTCCTCCTCCGTCCGCCC
HKR462444 RBdS156B20 pGCAP10 NM_004395.3  
GAGAGGCTCCGAGGCGGCGGCGGCGACTCCCTCTTTCCCTCCCTCCTCCTCCGTCCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl