Prev. |  KEGG KO K01876 > 

RIKEN DNA Bank Human Resource - DARS1

Gene ID NCBI Gene 1615 |  KEGG hsa:1615
Gene Symbol DARS1
Protein Name aspartyl-tRNA synthetase 1
Synonyms DARS|HBSL|aspRS
Ortholog resource in our bank

  DARS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13273 pUC-T7-EMCV-GST-AspRS EMCV IRES-dependent expression vector of human aspartyl-tRNA synthetase

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082037 IRAL005B13 pOTB7 BC000629 NM_001349 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050473 ARe26D01 pKA1U5 NM_001349.2  
GGGAAGCCTGCGAGGGAGGGTGGTGTCCACTGCCCAGNTTCCGTGTCCCGATGCCCAGCG
HKR162801 ARi07A01 pGCAP10 NM_001349.2  
GGTCCACTGCCCAGTTCCGTGTCCCGATGCCCAGCGCCAGCGCCAGCCGCAAGAGTCAGG
HKR243751 ARiS109G07 pGCAP10 NM_001349.2  
GAGGGAGGGTGGTGTCCACTGCCCAGTTCCGTGTCCCGATGCCCAGCGCCAGCGCCAGCC
HKR474808 RBdS187A08 pGCAP10 NM_001349.2  
GGGCCTGCCTTACGGAAGCCTGCGAGGGAGGGTGGTGTCCACTGCCCAGTTCCGTGTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl