Prev. |  KEGG KO K08803 > 

RIKEN DNA Bank Human Resource - DAPK3

Gene ID NCBI Gene 1613 |  KEGG hsa:1613
Gene Symbol DAPK3
Protein Name death associated protein kinase 3
Synonyms DLK|ZIP|ZIPK
Ortholog resource in our bank

  DAPK3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03160 ZIPK/pBluescript Plasmid clone of human zipper-interacting protein kinase cDNA
RDB03161 ZIPK/pGEX Plasmid clone of human zipper-interacting protein kinase cDNA
RDB03162 ZIPKK42A/pGEX Plasmid clone of human zipper-interacting protein kinase cDNA
RDB03163 ZIPK/pcDNA3.1 Plasmid clone of human zipper-interacting protein kinase cDNA
RDB03164 ZIPKK42A/pcDNA3.1 Expression vector of human zipper-interacting protein kinase cDNA
RDB03527 pAxCALNLhDAPK3 (forward) Shuttle vector to generate rAd harboring human DAPK3 (forward)
RDB03567 pAxCALNLhDAPK3 (forward) Shuttle vector to generate rAd harboring human DAPK3 (forward)
RDB04106 pAxCALNLhDAPK3 (reverse) Shuttle vector to generate rAd harboring human DAPK3
RDB04138 pAxCALNLhDAPK3 (reverse) Shuttle vector to generate rAd harboring human DAPK3

webcatalog20220516.tab


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022136 W01A055F16 pENTR-TOPO flj0018c02 AK074799 NM_001348  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180001 ARi50A01 pGCAP10 NM_001348.1  
GGCGGGGCTTCTGGAGGCGGCGGCGGTGGCCAGCGCGGCGGCGCCGGCCGTATTCTCCGG
HKR360570 RBd01H02 pGCAP10 NM_001348.1  
GGGAGGCGGCGGCGGTGGCCAGCGCGGCGGCGCCGGCCGTATTCTCCGGGCTGCGGAGGG
HKR409060 RBdS022K20 pGCAP10 NM_001348.1  
GGAGGCGGCGGCGGTGGCCAGCGCGGCGGCGCCGGCCGTATTCTCCGGGCTGCGGAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.18

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl