Prev. | 

RIKEN DNA Bank Human Resource - DAP

Gene ID NCBI Gene 1611 |  KEGG hsa:1611
Gene Symbol DAP
Protein Name death associated protein
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084916 IRAL012E20 pOTB7 BC002726 NM_004394 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040873 ARe02D01 pKA1U5 NM_004394.2  
GACTCACCCGGCTCGCGCGGCCCCGGCGCCCCACGCNTNGCGCGTCGTTTCTCCCGCCCG
HKR176031 ARi40B07 pGCAP10 NM_004394.2  
GCCGGCCCGAGAACCGCGCCGCCGCCTCGGCCCCGCGGAAGCCCCGCCGCGCCATGTCTT
HKR279484 ARiS198L20 pGCAP10 NM_004394.2  
CGGCCGGCCGATGACCCACCCGGCTCGCGCGGCCCCGGCGCCCCACGCGCGCGCGTCGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl