Prev. | Human A to Z list > D > 

RIKEN DNA Bank Human Resource - DGKA

Gene ID (NCBI) 1606
Gene Symbol DGKA
Protein Name diacylglycerol kinase, alpha 80kDa
Synonyms DAGK|DAGK1|DGK-alpha
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00901)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY028436 IRAK071B12 pBluescriptR BC031870 NM_201554 Full/var
HGY087184 IRAL017P24 pOTB7 BC023523 NM_201554 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098821 M01C047A21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE098869 M01C047C21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE098917 M01C047E21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE098965 M01C047G21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE099013 M01C047I21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE099061 M01C047K21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE099109 M01C047M21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE099157 M01C047O21 pDONR221 MGC13-A11 BC023523 NM_201554  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064412 ARe61A12 pKA1U5 NM_201444.2  
AGCTCGGGCTCCAGCTCCAGCGCCGGCGCTTCCNCTGCGACCGCGAGCCCTCTCAAGCAA
HKR078923 ARe97F03 pKA1U5 NM_201444.2  
GGGGCTCCAGCTCCAGCGCCGGCGCTTCAGCTGCGACCGCGAGCCCTCTCAAGNAAGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl