Prev. |  KEGG KO K00901 > 

RIKEN DNA Bank Human Resource - DGKA

Gene ID NCBI Gene 1606 |  KEGG hsa:1606
Gene Symbol DGKA
Protein Name diacylglycerol kinase alpha
Synonyms DAGK|DAGK1|DGK-alpha
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  DGKA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028436 IRAK071B12 pBluescriptR BC031870 NM_201554 Full/var
HGY087184 IRAL017P24 pOTB7 BC023523 NM_201554 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098821 M01C047A21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE098869 M01C047C21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE098917 M01C047E21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE098965 M01C047G21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE099013 M01C047I21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE099061 M01C047K21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE099109 M01C047M21 pDONR221 MGC13-A11 BC023523 NM_201554  
HGE099157 M01C047O21 pDONR221 MGC13-A11 BC023523 NM_201554  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064412 ARe61A12 pKA1U5 NM_201444.2  
AGCTCGGGCTCCAGCTCCAGCGCCGGCGCTTCCNCTGCGACCGCGAGCCCTCTCAAGCAA
HKR078923 ARe97F03 pKA1U5 NM_201444.2  
GGGGCTCCAGCTCCAGCGCCGGCGCTTCAGCTGCGACCGCGAGCCCTCTCAAGNAAGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl