Prev. |  KEGG KO K06265 > 

RIKEN DNA Bank Human Resource - DAG1

Gene ID NCBI Gene 1605 |  KEGG hsa:1605
Gene Symbol DAG1
Protein Name dystroglycan 1
Synonyms 156DAG|A3a|AGRNR|DAG|LGMDR16|MDDGA9|MDDGC7|MDDGC9
Ortholog resource in our bank

  DAG1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080784 IRAL001P24 pOTB7 BC014616 NM_004393 Full/var
HGY084239 IRAL010J23 pOTB7 BC014616 NM_004393 Full/var
HGY090366 IRAL025P06 pOTB7 BC012740 NM_004393 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE008859 W01A022C11 pENTR-TOPO IRAL010J23 BC014616 NM_004393  
HGE008861 W01A022C13 pENTR-TOPO IRAL010J23 BC014616 NM_004393  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162055 ARi05C07 pGCAP10 NM_004393.2  
GGAAGGCTGCGGCGCGGCGCTCGCGCCTCTTAGGCTTGGCGGTGGCGGCGGCGGCAGCTT
HKR172853 ARi32C05 pGCAP10 NM_004393.2  
GAGGCTTGGCGGTGGCGGCGGCGGCAGCTTCGCGCCGAATCCCCGGGGAGCGGCGGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl