Prev. |  KEGG KO K12668 > 

RIKEN DNA Bank Human Resource - DAD1

Gene ID NCBI Gene 1603 |  KEGG hsa:1603
Gene Symbol DAD1
Protein Name defender against cell death 1
Synonyms OST2
Ortholog resource in our bank

  DAD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01608 DAD1 Human DAD1 (Defender against death 1) cDNA
RDB02314 pAxCAhDAD1 (forward) Shuttle vector to produce rAd expressing human DAD1
RDB02315 pAxCAhDAD1 (reverse) Shuttle vector to produce rAd expressing human DAD1
RDB02673 pAxCALNLhDAD1 (forward) Shuttle vector to produce rAd expressing human DAD1
RDB02674 pAxCALNLhDAD1 (reverse) Shuttle vector to produce rAd expressing human DAD1
RDB02749 AxCAhDAD1 (forward) Recombinant adenovirus harboring human DAD1 cDNA
RDB02789 AxCALNLhDAD1 (forward) Recombinant adenovirus harboring human DAD1 cDNA

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081391 IRAL003H23 pOTB7 BC007403 NM_001344 Full
HGY087893 IRAL019M05 pDNR-LIB BC009798 NM_001344 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE003835 W01A009J19 pENTR-TOPO IRAL019M05 BC009798 NM_001344  
HGE045126 W01A112N14 pENTR-TOPO IRAL003H23 BC007403 NM_001344  
HGE045128 W01A112N16 pENTR-TOPO IRAL003H23 BC007403 NM_001344  
HGE045132 W01A112N20 pENTR-TOPO IRAL003H23 BC007403 NM_001344  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050571 ARe26H03 pKA1U5 NM_001344.2  
GGGGTCCTCCAAGAGGTTTGGGGCGCGGCACCGNTAGTACCGTTGGCGCTGTNANCTTAT
HKR166450 ARi16C02 pGCAP10 NM_001344.2  
GAGAGTTTGGGGCGCGGACCGGAGTACCTTGCGTGCAGTTATGTCGGCGTCGGTAGTGTC
HKR177731 ARi44F11 pGCAP10 NM_001344.2  
GGGTCCTCCAAGAGTTTGGGGCGCGGACCGGAGTACCTTGCGTGCAGTTATGTCGGCGTC
HKR184897 ARi62E01 pGCAP10 NM_001344.2  
TGGTGGTCGACGGGTCCTCCAAGAGTTTGGGGCGCGGACCGGAGTACCTTGCGTGCAGTT
HKR397658 RBd94C10 pGCAP10 NM_001344.2  
GGCAAACAGCACATCCGGTGTGGTCGACGGGTCCTCCAAGAGTTTGGGGCGCGGACTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl