Prev. |  KEGG KO K05917 > 

RIKEN DNA Bank Human Resource - CYP51A1

Gene ID NCBI Gene 1595 |  KEGG hsa:1595
Gene Symbol CYP51A1
Protein Name cytochrome P450 family 51 subfamily A member 1
Synonyms CP51|CYP51|CYPL1|LDM|P450-14DM|P450L1
Ortholog resources KEGG ortholog (KEGG orthology K05917) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025955 IRAK064O19 pCMV-SPORT6 BC032322 NM_000786 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR177778 ARi44H10 pGCAP10 NM_000786.3  
GAGCGCCTTCAACGCCGTGTCCCGGCACCCCGCACCCGGGCACACAAAAAACGGGTCGCC
HKR340802 RBb52A02 pGCAP1 NM_000786.3  
AGTAGGAGACCTGGGGCAAGGCCCCCTGTGGACGACCATCTGCCAGCTTCTCTCGTTCCG
HKR398027 RBd95B03 pGCAP10 NM_000786.3  
GCTCTCGTTCCGTCGATTGGGAGGAGCGGTGGCGACCTCGGCCTTCAGTGTTTCCGACGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl