Prev. |  KEGG KO K07436 > 

RIKEN DNA Bank Human Resource - CYP24A1

Gene ID NCBI Gene 1591 |  KEGG hsa:1591
Gene Symbol CYP24A1
Protein Name cytochrome P450 family 24 subfamily A member 1
Synonyms CP24|CYP24|HCAI|HCINF1|P450-CC24
Ortholog resources KEGG ortholog (KEGG orthology K07436) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040550 ARe01G06 pKA1U5 NM_000782.4  
GATGGAGAGGGACAGGAGGAAACGCAGCGCCAGCAGNATCTCATCTACCCTCCTTGACAC
HKR040905 ARe02E09 pKA1U5 NM_000782.4  
GGGAGAGGGACAGGAGGAAACGCAGCGCCAGCAGCATCTCATCTACCCTCCTTGACACCT
HKR168882 ARi22D10 pGCAP10 NM_000782.4  
GATGGAGAGGGACAGGAGGAAACGCAGCGCCAGCAGCATCTCATCTACCCTCCTTGACAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl