Prev. |  KEGG KO K00413 > 

RIKEN DNA Bank Human Resource - CYC1

Gene ID NCBI Gene 1537 |  KEGG hsa:1537
Gene Symbol CYC1
Protein Name cytochrome c1
Synonyms MC3DN6|UQCR4
Ortholog resources KEGG ortholog (KEGG orthology K00413) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008069 IRAK020C21 pCMV-SPORT6 BC020566 NM_001916
HGX011659 IRAK029C11 pCMV-SPORT6 BC024650 NM_001916 Partial
HGY080560 IRAL001G16 pOTB7 BC001006 NM_001916 Full
HGY093505 IRAL033M17 pOTB7 BC015616 NM_001916 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005683 W01A014D11 pENTR-TOPO IRAK020C21 BC020566 NM_001916  
HGE005691 W01A014D19 pENTR-TOPO IRAL001G16 BC001006 NM_001916  
HGE005695 W01A014D23 pENTR-TOPO IRAL001G16 BC001006 NM_001916  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070001 ARe75A01 pKA1U5 NM_001916.3  
TGGGCGCGGAGGAGGCCAAGATGGCGGCAGCTNCGNNTTCGCTTCGCGGGGTAGCTGTTG
HKR171234 ARi28B10 pGCAP10 NM_001916.3  
GGGGAGTGGCGGCCGCGCGGAGGAGGCCAAGATGGCGGCAGCTGCGGCTTCGCTTCGCGG
HKR324154 RBb10G10 pKA1U5 NM_001916.3  
GGCGGCCGCGCGGTAGGTAGGCCAAGATGGCGGCAGCTTGCGGCTTCGCTTCGCGGGGTA
HKR328036 RBb20B12 pKA1U5 NM_001916.3  
GGGCCGCGCGGAGGAGGCCAAGATGGCGGCAGCTGCGGCTTCGCTTCGCGGGGTAGTGTT
HKR336169 RBb40H01 pGCAP1 NM_001916.3  
TGTGCGGCCGCGCGGAGGAGGCCAAGATGGCGGCAGCTGCGGCTTCGCTTCGCGGGGTAG
HKR374931 RBd37F11 pGCAP10 NM_001916.3  
GAGGGGCCGACGGGAGTGGCGGCCGCGCGGAGGAGGCCAAGATGGCGGCAGCTGCGGCTT
HKR405264 RBdS013C16 pGCAP10 NM_001916.3  
GGCGGAGGAGGCCAAGATGGCGGCAGCTGCGGCTTCGCTTCGCGGGGTAGTGTTGGGCCC
HKR405890 RBdS014M02 pGCAP10 NM_001916.3  
GGCCGACGGGAGTGGCGGCCGCGCGGAGGAGGCCAAGATGGCGGCAGCTGCGGCTTCGCT
HKR420490 RBdS051D18 pGCAP10 NM_001916.3  
GGACGGGAGTGGCGGCCGCGCGGAGGAGGCCAAGATGGCGGCAGCTGCGGCTTCGCTTCG
HKR433217 RBdS083A17 pGCAP10 NM_001916.3  
GGCGGAGGAGGCCAAGATGGCGGCAGCTGCGGCTTCGCTTCGCGGGGTAGTGTTGGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl