Prev. |  KEGG KO K08009 > 

RIKEN DNA Bank Human Resource - CYBA

Gene ID NCBI Gene 1535 |  KEGG hsa:1535
Gene Symbol CYBA
Protein Name cytochrome b-245 alpha chain
Synonyms p22-PHOX
Ortholog resource in our bank

  CYBA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082532 IRAL006F12 pOTB7 BC006465 NM_000101 Full/var
HGY091751 IRAL029G07 pOTB7 BC011565 NM_000101

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040132 W01A100F12 pENTR-TOPO IRAL006F12 BC006465 NM_000101  
HGE040134 W01A100F14 pENTR-TOPO IRAL006F12 BC006465 NM_000101  
HGE040170 W01A100H02 pENTR-TOPO IRAL006F12 BC006465 NM_000101  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044053 ARe10C05 pKA1U5 NM_000101.2  
GGGCAGATGCGCGCCTAGCAGATGTCCCAGCCGGGCTTCGATGTCGCCATGGGGCAGATC
HKR055708 ARe39E12 pKA1U5 NM_000101.2  
GGGGGCGGGGNTTCGGCCGGGTAGCGCAGGGGCGCCCATTTCNCGCCTAGCAGTGTCCCA
HKR075678 ARe89D06 pKA1U5 NM_000101.2  
GGGCCGGGAGCGCANGGGCGGCAGNTGCGCGCCTANCAGATGNTCCCAGCCGGGATTCGT
HKR234809 ARiS087A09 pGCAP10 NM_000101.2  
GGCGCGCCTANCANNGTCCCANCCGGGTTCGTGTCGCCATGGGGCAGATCGAGTGGGCCA
HKR235501 ARiS088M13 pGCAP10 NM_000101.2  
GAGTGCGCGCCTAGCAGTGTCCCAGCCGGGTTCGTGTCGCCATGGGGCAGATCGAGTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl