Prev. |  KEGG KO K06788 > 

RIKEN DNA Bank Human Resource - CXADR

Gene ID NCBI Gene 1525 |  KEGG hsa:1525
Gene Symbol CXADR
Protein Name CXADR Ig-like cell adhesion molecule
Synonyms CAR|CAR4/6|HCAR
Ortholog resource in our bank

  CXADR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04627 pAxCALNLhCAR(forward) Shuttle vector to generate rAd expressing human CXADR
RDB04651 pAxCALNLhCAR(reverse) Shuttle vector to generate rAd expressing human CXADR
RDB04660 pAxCALNLhCAR(forward) Shuttle vector to generate rAd expressing human CXADR
RDB04723 pAxCALNLhCAR(reverse) Shuttle vector to generate rAd expressing human CXADR
RDB07021 pCMFlag_hsCXADR Expression vector of human CXADR.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001790 IRAK004H22 pCMV-SPORT6 BC003684 NM_001338 Full
HGX007727 IRAK019F07 pCMV-SPORT6 BC010536 NM_001338 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218168 ARiS045G24 pGCAP10 NM_001338.3  
GGCAGAGGTGCCGCCGCCGCCGCGAGCCAGTCGGGAGCGCGCGAGGCGCGGGGAGCCTGG
HKR362932 RBd07F12 pGCAP10 NM_001338.3  
GGTGCCGCCGCCGCCGCGAGCCAGTCGGGAGCGCGCGAGGCGCGGGGAGCCTGGGACCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl