Prev. |  KEGG KO K09313 > 

RIKEN DNA Bank Human Resource - CUX1

Gene ID NCBI Gene 1523 |  KEGG hsa:1523
Gene Symbol CUX1
Protein Name cut like homeobox 1
Synonyms CASP|CDP|CDP/Cut|CDP1|COY1|CUTL1|CUX|Clox|Cux/CDP|GDDI|GOLIM6|Nbla10317|p100|p110|p200|p75
Ortholog resources KEGG ortholog (KEGG orthology K09313) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX055838 IRAK139J22 pCMV-SPORT6 BC066592 NM_181552 Partial/var
HGY087326 IRAL018F06 pOTB7 BC007204

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR067377 ARe68H09 pKA1U5 NM_181552.2  
GACTCCGTCTCAATATGTCTCAAGATGGCGGCCAATGTGGGATCGATGTTTCAATATTGG
HKR277952 ARiS194O16 pGCAP10 NM_181552.2  
GACTCCNNCTCAATATGTCTCAAGATGGCGGCCAATGTGGGATCGATGTTTCAATATTGG
HKR344408 RBb61A08 pGCAP1 NM_181552.2  
GACTCCGTCTCAATATGTCTCAAGATGGCGGCCAATGTGGGATCGATGTTTCAATATTGG
HKR430326 RBdS075N14 pGCAP10 NM_181552.2  
GGCCGCCCGCCTGCTGCCTCCTGGCGGCTCCTGAACTCCAGCCCCCTCTCTATCAGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl