Prev. |  KEGG KO K08568 > 

RIKEN DNA Bank Human Resource - CTSZ

Gene ID NCBI Gene 1522 |  KEGG hsa:1522
Gene Symbol CTSZ
Protein Name cathepsin Z
Synonyms CTSX
Featured content Lysosome (human)
Featured content Apoptosis - human
Ortholog resource in our bank

  CTSZ

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091329 IRAL028F09 pOTB7 BC025419 NM_001336
HGY097788 IRAL044H20 pOTB7 BC042168 NM_001336 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047235 ARe18B11 pKA1U5 NM_001336.2  
GGCGGGGTCGGCCGGGTGCTAGGCCGGGGCCGAGGCCGAGGCCGGGGCGGGATCCAGAGC
HKR222384 ARiS055P24 pGCAP10 NM_001336.2  
GAAAGTGCGGGGTCGGCCGGGTGCTAGGCCGGGGCCGAGGCCGAGGCCGGGGCGGGATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl