Prev. |  KEGG KO K08568 > 

RIKEN DNA Bank Human Resource - CTSZ

Gene ID NCBI Gene 1522 |  KEGG hsa:1522
Gene Symbol CTSZ
Protein Name cathepsin Z
Synonyms CTSX
Ortholog resources KEGG ortholog (KEGG orthology K08568) in the DNA Bank
Featured content Lysosome (human)
Featured content Apoptosis - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097788 IRAL044H20 pOTB7 BC042168 NM_001336 Full
HGY091329 IRAL028F09 pOTB7 BC025419 NM_001336

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047235 ARe18B11 pKA1U5 NM_001336.2  
GGCGGGGTCGGCCGGGTGCTAGGCCGGGGCCGAGGCCGAGGCCGGGGCGGGATCCAGAGC
HKR222384 ARiS055P24 pGCAP10 NM_001336.2  
GAAAGTGCGGGGTCGGCCGGGTGCTAGGCCGGGGCCGAGGCCGAGGCCGGGGCGGGATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl