Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CTSL

Gene ID (NCBI) 1514
Gene Symbol CTSL
Protein Name cathepsin L
Synonyms CATL|CTSL1|MEP
Databases KEGG hsa:1514 |  NCBI Gene 1514
Featured content Lysosome (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01365)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05229 pAxCALNLhCTSL(forward) Shuttle vector to generate rAd expressing human CTSL
RDB05230 pAxCALNLhCTSL(reverse) Shuttle vector to generate rAd expressing human CTSL

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087954 IRAL019O18 pDNR-LIB BC012612 NM_145918 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR165756 ARi14G12 pGCAP10 NM_001912.4  
GAGCAGGAAGCGCCGCCGGCCAGGCCCAGCTGTGGCCGGACAGGGACTGGAAGAGAGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl