Prev. |  KEGG KO K01365 > 

RIKEN DNA Bank Human Resource - CTSL

Gene ID NCBI Gene 1514 |  KEGG hsa:1514
Gene Symbol CTSL
Protein Name cathepsin L
Synonyms CATL|CTSL1|MEP
Featured content Lysosome (human)
Featured content Apoptosis - human
Featured content SARS-CoV-2 relevant human genes
Ortholog resource in our bank

  CTSL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05229 pAxCALNLhCTSL(forward) Shuttle vector to generate rAd expressing human CTSL
RDB05230 pAxCALNLhCTSL(reverse) Shuttle vector to generate rAd expressing human CTSL

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087954 IRAL019O18 pDNR-LIB BC012612 NM_145918 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR165756 ARi14G12 pGCAP10 NM_001912.4  
GAGCAGGAAGCGCCGCCGGCCAGGCCCAGCTGTGGCCGGACAGGGACTGGAAGAGAGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl