DNA Bank Top |  KEGG KO K01365 > 

RIKEN DNA Bank Human Resource - CTSL

Gene ID NCBI Gene 1514 |  KEGG hsa:1514
Gene Symbol CTSL
Protein Name cathepsin L
Synonyms CATL|CTSL1|MEP
Featured content Lysosome (human)
Featured content Apoptosis - human
Featured content SARS-CoV-2 relevant human genes

Link

Ortholog resource in our bank

  CTSL

External database

human CTSL

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB05230 pAxCALNLhCTSL(reverse) Shuttle vector to generate rAd expressing human CTSL    
RDB05229 pAxCALNLhCTSL(forward) Shuttle vector to generate rAd expressing human CTSL    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087954 IRAL019O18 pDNR-LIB BC012612 NM_145918 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR165756 ARi14G12 pGCAP10 NM_001912.4  
GAGCAGGAAGCGCCGCCGGCCAGGCCCAGCTGTGGCCGGACAGGGACTGGAAGAGAGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl