Prev. |  KEGG KO K01366 > 

RIKEN DNA Bank Human Resource - CTSH

Gene ID NCBI Gene 1512 |  KEGG hsa:1512
Gene Symbol CTSH
Protein Name cathepsin H
Synonyms ACC-4|ACC-5|ACC4|ACC5|CPSB
Ortholog resources KEGG ortholog (KEGG orthology K01366) in the DNA Bank
Featured content Lysosome (human)
Featured content Apoptosis - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082286 IRAL005L22 pOTB7 BC002479 NM_004390 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050926 ARe27F06 pKA1U5 NM_004390.3  
GAGTTGACGCTCTGGGCCGCCACCTCCGCGGACCCTGAGCGCAAGAGCCAAGCCGCCAGC
HKR056172 ARe40H04 pKA1U5 NM_004390.3  
GGTGGGCCACGCTGCCGCTGCTCTGCGCCGGGGCCTGGCTCCTGGGAGTCCCCGNTCTGC
HKR065608 ARe64A08 pKA1U5 NM_004390.3  
GAGTTGACGCTCTGGTCCGCCACCTCCGCGGACCCTGTAGCGCAAGAGCCAAGCCCCCAG
HKR177226 ARi43B02 pGCAP10 NM_004390.3  
GAGTTGACGCTCTGGGCCGCCACCTCCGCGGACCCTGAGCGCAAGAGCCAAGCCGCCAGC
HKR219605 ARiS049A05 pGCAP10 NM_004390.3  
GAGTTGACGCTCTGGGCCGCCACCTCCGCGGACCCTGAGCGCAAGAGCCAAGCCGCCAGC
HKR238468 ARiS096C20 pGCAP10 NM_004390.3  
GAGTTGACGCTCTGGGCCGCCACCTCCGCGGACCCTGAGCGCAAGAGCCAAGCCGCCAGC
HKR243819 ARiS109J03 pGCAP10 NM_004390.3  
GGCAAGAGCCAAGCCGCCAGCGCTGCTATGTGGGCCACGCTGCCGCTGCTCTGCGCCGGG
HKR249057 ARiS122K17 pGCAP10 NM_004390.3  
GAGCCAAGCCGCCAGCGCTGCTATGTGGGCCACGCTGCCGCTGCTCTGCGCCGGGGCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl