Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CTSD

Gene ID (NCBI) 1509
Gene Symbol CTSD
Protein Name cathepsin D
Synonyms CLN10|CPSD|HEL-S-130P
Databases KEGG hsa:1509 |  NCBI Gene 1509
Featured content Sphingolipid signaling pathway (human)
Featured content Lysosome (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01379)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05233 pAxCALNLhCTSD(forward) Shuttle vector to generate rAd expressing human CTSD
RDB05234 pAxCALNLhCTSD(reverse) Shuttle vector to generate rAd expressing human CTSD

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083150 IRAL007O14 pOTB7 BC016320 NM_001909 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161230 ARi03B06 pGCAP10 NM_001909.3  
GGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCT
HKR045611 ARe14A11 pKA1U5 NM_001909.3  
GACGGCCTCGGCGACCCTCTCCGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCT
HKR046931 ARe17F11 pKA1U5 NM_001909.3  
AACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACCCTCTCCGACCCGGCCG
HKR051254 ARe28C06 pKA1U5 NM_001909.3  
ATCCTGTGGGGCGGCGTCATCCCGGCTATAAGCGCACNGCCTCGGCGACCCTCTCCGACC
HKR168025 ARi20B01 pGCAP10 NM_001909.3  
GAAAAACACGCGGGTCAGCTGATCCGGCCCAACTGCGGCGTCNNNCNGGCTATAAGCGCA
HKR172132 ARi30F12 pGCAP10 NM_001909.3  
GAAGCGCACGGCCTCGGCGACCCTCTCCGACCCGGCCGCCGCCGCCATGCAGCCCTCCAG
HKR058125 ARe45F05 pKA1U5 NM_001909.3  
GACCGGTCCGGGTGCAAACACGCGGGTCAGCTGATCCGGCCCAACTGCGGCGTCATCCCG
HKR058434 ARe46B10 pKA1U5 NM_001909.3  
GCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCTGGC
HKR062881 ARe57D09 pKA1U5 NM_001909.3  
GGCACGGCCTCGGCGACCCTCTCCGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTT
HKR063612 ARe59A12 pKA1U5 NM_001909.3  
GGGCGACCCTCTCCGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCG
HKR187374 ARi68H06 pGCAP10 NM_001909.3  
GGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCT
HKR070523 ARe76F03 pKA1U5 NM_001909.3  
GGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCT
HKR188569 ARi71H01 pGCAP10 NM_001909.3  
GGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCT
HKR073652 ARe84C04 pKA1U5 NM_001909.3  
GGCAAACACGCGGGTCAGCTGATCCGGCCCAACTGCGGCGTCATCCCGGCTATAAGCGCA
HKR076497 ARe91E01 pKA1U5 NM_001909.3  
GGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCT
HKR234964 ARiS087G20 pGCAP10 NM_001909.3  
CGGCCGGCCGATGGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGC
HKR235034 ARiS087J18 pGCAP10 NM_001909.3  
GGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCT
HKR238466 ARiS096C18 pGCAP10 NM_001909.3  
GGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCT
HKR238679 ARiS096L15 pGCAP10 NM_001909.3  
GGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCT
HKR243683 ARiS109D11 pGCAP10 NM_001909.3  
GATCCCGGCTATAAGCGCACGGCCTCGGCGACCCTCTCCGACCCGGCCGCCGCCGCCATG
HKR247507 ARiS118M19 pGCAP10 NM_001909.3  
GGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCT
HKR248807 ARiS122A07 pGCAP10 NM_001909.3  
GGACCCGGCCGCCGCCGCCNTNCANCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCT
HKR248874 ARiS122D02 pGCAP10 NM_001909.3  
GAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACCCTCTCCGACCCGGCC
HKR260339 ARiS150O03 pGCAP10 NM_001909.3  
GGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCT
HKR279535 ARiS198N23 pGCAP10 NM_001909.3  
HKR328005 RBb20A05 pKA1U5 NM_001909.3  
GCGGCCCAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACCCTCTCCGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl