Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CTSB

Gene ID (NCBI) 1508
Gene Symbol CTSB
Protein Name cathepsin B
Synonyms APPS|CPSB
Databases KEGG hsa:1508 |  NCBI Gene 1508
Featured content Lysosome (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01363)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162403 ARi06A03 pGCAP10 NM_001908.3  
GGGCGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACGCCAACCGCTCCGCTGCGCGCAGG
HKR163209 ARi08A09 pGCAP10 NM_001908.3  
GGCGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACGCCAACCGCTCCGCTGCGCGCAGGC
HKR164050 ARi10C02 pGCAP10 NM_001908.3  
CGGCCGGCCGATGGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACGCCAACCGCTCCGCT
HKR048834 ARe22B10 pKA1U5 NM_001908.3  
GGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACGCCAACCGCTCCGCTGCGCGCAGGCTG
HKR171373 ARi28H05 pGCAP10 NM_001908.3  
GGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACGCCAACCGCTCCGCTGCGCGCAGGCTG
HKR052153 ARe30G09 pKA1U5 NM_001908.3  
GGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACGCCAACCGCTCCGCTGCGCGCAGGCTG
HKR056031 ARe40B07 pKA1U5 NM_001908.3  
GGCTGCAGGGCTCCGGCAACCGCTCCGGCAACGCCAACCGCTCCGCTGCGCGCAGGCTGG
HKR056875 ARe42D03 pKA1U5 NM_001908.3  
GAGGCTACGGCGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACGCCAACCGCTCCGCTGC
HKR060454 ARe51C06 pKA1U5 NM_001908.3  
TGAGGGGCCGGGGCTGGCCCAGGCTACGGCGGCTGCAGGGCTCCGGCAACCGCTCCGGCA
HKR061675 ARe54D03 pKA1U5 NM_001908.3  
GGGGCCGGGGCTGGCCCAGGCTACGGCGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACG
HKR187749 ARi69G05 pGCAP10 NM_001908.3  
GGGCGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACGCCAACCGCTCCGCTGCGCGCAGG
HKR218128 ARiS045F08 pGCAP10 NM_001908.3  
GGGCGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACGCCAACCGCTCCGCTGCGCGCAGG
HKR325206 RBb13A06 pKA1U5 NM_001908.3  
GCCCTTCCGCTCGGGGATCCGGGGCCACCGCCGGGGGCGGGCGGGGGCCTGAGCGCGCGG
HKR394101 RBd85E05 pGCAP10 NM_001908.3  
GGGGCCGGGGCTGGCCCAGGCTACGGCGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACG
HKR405554 RBdS013O18 pGCAP10 NM_001908.3  
GGCGGCTGCAGGGCTCCGGCAACCGCTCCGGCAACGCCAACCGCTCCGCTGCGCGCAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl