DNA Bank Top |  KEGG KO K02105 > 

RIKEN DNA Bank Human Resource - CTNNB1

Gene ID NCBI Gene 1499 |  KEGG hsa:1499
Gene Symbol CTNNB1
Protein Name catenin beta 1
Synonyms CTNNB|EVR7|MRD19|NEDSDV|armadillo
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Wnt signaling pathway (human)

Link

Ortholog resource in our bank

  CTNNB1


External database

human CTNNB1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB13079 CMV-GFP-CTNNB1(S45A) Expression plasmid of human catenin beta 1, S45A mutant form tagged with GFP. Gateway(R) expression clone.    
RDB13078 CMV-GFP-CTNNB1(V584I) Expression plasmid of human catenin beta 1, V584I mutant form tagged with GFP. Gateway(R) expression clone.    
RDB13077 CMV-GFP-CTNNB1(H578Q) Expression plasmid of human catenin beta 1, H578Q mutant form tagged with GFP. Gateway(R) expression clone.    
RDB13076 CMV-GFP-CTNNB1(C429S) Expression plasmid of human catenin beta 1, C429S mutant form tagged with GFP. Gateway(R) expression clone.    
RDB13075 CMV-GFP-CTNNB1(C419*) Expression plasmid of human catenin beta 1, C419* mutant form tagged with GFP. Gateway(R) expression clone.    
RDB13074 CMV-GFP-CTNNB1(K233E) Expression plasmid of human catenin beta 1, K233E mutant form tagged with GFP. Gateway(R) expression clone.    
RDB13073 CMV-GFP-CTNNB1(V195E) Expression plasmid of human catenin beta 1, V195E mutant form tagged with GFP. Gateway(R) expression clone.    
RDB13072 CMV-GFP-CTNNB1(T42I) Expression plasmid of human catenin beta 1, T42I mutant form tagged with GFP. Gateway(R) expression clone.    
RDB13071 CMV-GFP-CTNNB1(WT) Expression plasmid of human catenin beta 1, wild type tagged with GFP. Gateway(R) expression clone.    
RDB13070 CMV-V5-CTNNB1(S45A) Expression plasmid of human catenin beta 1, S45A mutant form. Gateway(R) expression clone.    
RDB13069 CMV-V5-CTNNB1(V584I) Expression plasmid of human catenin beta 1, V584I mutant form. Gateway(R) expression clone.    
RDB13068 CMV-V5-CTNNB1(H578Q) Expression plasmid of human catenin beta 1, H578Q mutant form. Gateway(R) expression clone.    
RDB13067 CMV-V5-CTNNB1(C429S) Expression plasmid of human catenin beta 1, C429S mutant form. Gateway(R) expression clone.    
RDB13066 CMV-V5-CTNNB1(C419*) Expression plasmid of human catenin beta 1, C419* mutant form. Gateway(R) expression clone.    
RDB13065 CMV-V5-CTNNB1(K233E) Expression plasmid of human catenin beta 1, K233E mutant form. Gateway(R) expression clone.    
RDB13064 CMV-V5-CTNNB1(V195E) Expression plasmid of human catenin beta 1, V195E mutant form. Gateway(R) expression clone.    
RDB13063 CMV-V5-CTNNB1(T42I) Expression plasmid of human catenin beta 1, T42I mutant form. Gateway(R) expression clone.    
RDB13062 CMV-V5-CTNNB1(WT) Expression plasmid of human catenin beta 1, wild type. Gateway(R) expression clone.    
RDB05938 pAxCALNLhCTNNB1 (reverse) Shuttle vector to generate rAd harboring human CTNNB1 (reverse)    
RDB05937 pAxCALNLhCTNNB1 (forward) Shuttle vector to generate rAd harboring human CTNNB1 (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX047902 IRAK119M14 pCMV-SPORT6 BC058926 NM_001904 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE003020 W01A007J04 pENTR-TOPO IRAK119M14 BC058926 NM_001904.4 full done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168580 ARi21H12 pGCAP10 NM_001904.3  
GAAGCCTCTCGGTCTGTGGCAGCAGCGTTGGCCCGGCCCCGGGAGCGGAGAGCGAGGGGA
HKR186452 ARi66C04 pGCAP10 NM_001904.3  
GCCTTCCGGGGCTGCTCCCGCTTCCTCTCGGAGCCAAACTTCGTAGCAGGCGCGCGGTCC
HKR277752 ARiS194G08 pGCAP10 NM_001904.3  
CGGCCGNNNNATGANNCCTCTCGGTCTGTGGCAGCAGCGTTGGCCCGGCCCCGGGAGCGG
HKR361726 RBd04F06 pGCAP10 NM_001904.3  
GAAGCCTCTCGGTCTGTGGCAGCAGCGTTGGCCCGGCCCCGGGAGCGGAGAGCGAGGGGA
HKR392929 RBd82F09 pGCAP10 NM_001904.3  
GAAGCCTCTCGGTCTGTGGCAGCAGCGTTGGCCCGGCCCCGGGAGCGGAGAGCGAGGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl