Prev. |  KEGG KO K05691 > 

RIKEN DNA Bank Human Resource - CTNNA1

Gene ID NCBI Gene 1495 |  KEGG hsa:1495
Gene Symbol CTNNA1
Protein Name catenin alpha 1
Synonyms CAP102|MDPT2
Ortholog resources KEGG ortholog (KEGG orthology K05691) in the DNA Bank
Featured content Hippo signaling (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY025427 IRAK063J11 pBluescriptR BC031262 NM_001903 Partial/var
HGY080508 IRAL001E12 pOTB7 BC000385 NM_001903 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081240 M01C003B16 pDONR221 04-134-2_2-D08 BC000385 NM_001903  
HGE081288 M01C003D16 pDONR221 04-134-2_2-D08 BC000385 NM_001903  
HGE081336 M01C003F16 pDONR221 04-134-2_2-D08 BC000385 NM_001903  
HGE081384 M01C003H16 pDONR221 04-134-2_2-D08 BC000385 NM_001903  
HGE081432 M01C003J16 pDONR221 04-134-2_2-D08 BC000385 NM_001903  
HGE081480 M01C003L16 pDONR221 04-134-2_2-D08 BC000385 NM_001903  
HGE081528 M01C003N16 pDONR221 04-134-2_2-D08 BC000385 NM_001903  
HGE081576 M01C003P16 pDONR221 04-134-2_2-D08 BC000385 NM_001903  
HGE110834 M01C077B10 pDONR221 06-2_02-D05 BC000385 NM_001903  
HGE110882 M01C077D10 pDONR221 06-2_02-D05 BC000385 NM_001903  
HGE088416 M01C021A16 pDONR221 IMS03-B08 BC000385 NM_001903  
HGE088464 M01C021C16 pDONR221 IMS03-B08 BC000385 NM_001903  
HGE088512 M01C021E16 pDONR221 IMS03-B08 BC000385 NM_001903  
HGE088560 M01C021G16 pDONR221 IMS03-B08 BC000385 NM_001903  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE041271 W01A103C23 pENTR-TOPO IRAK063J11 BC031262 NM_001903  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR160500 ARi01E04 pGCAP10 NM_001903.2  
GGGCCCATTTCCTCCTCCTAGCCGGACTGGAGGGAGACAAAGCAGCGCCCGTCTGCTTCG
HKR184529 ARi61F09 pGCAP10 NM_001903.2  
GCCTCCTCCTAGCCGGACTGGAGGGAGACAAAGCAGCGCCCGTCTGCTTCGGGCCTCTGG
HKR264538 ARiS161F18 pGCAP10 NM_001903.2  
GCTCTGGAATTTAGCGCTCGCCCAGCTAGCCGCAGATGGAGTTTTGCTCTTGTTGCCCAG
HKR276706 ARiS191M18 pGCAP10 NM_001903.2  
TGCTCTGGAATTTAGCGCTCGCCCAGCTAGCCGCAGAAATGACTGCTGTCCATGCAGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl