Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CTGF

Gene ID (NCBI) 1490
Gene Symbol CTGF
Protein Name connective tissue growth factor
Synonyms CCN2|HCS24|IGFBP8|NOV2
Databases KEGG hsa:1490 |  NCBI Gene 1490
Featured content Hippo signaling (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06827)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07807 pGL4-phCTGF Promoter collection, Human CTGF promoter.

RDB_org_170226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047732 ARe19F12 pKA1U5 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGATGCGACTCCACCCTCCAGCTC
HKR054035 ARe35B11 pKA1U5 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR054833 ARe37B09 pKA1U5 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR055252 ARe38C04 pKA1U5 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGATGCGACTCCACCCTCCAGCTC
HKR055635 ARe39B11 pKA1U5 NM_001901.2  
GACACACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGNTGCGACTCCACCCTCCA
HKR056551 ARe41G07 pKA1U5 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCANTTGCGACTCCACCCTCCAGCTC
HKR058480 ARe46D08 pKA1U5 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR062898 ARe57E02 pKA1U5 NM_001901.2  
GACACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCT
HKR064102 ARe60E06 pKA1U5 NM_001901.2  
ANTCNGGAACTTTTTTTTNTTNATANNANANANNNNTTGTNANTNNANTNTTTATTTTTA
HKR071629 ARe79B05 pKA1U5 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR078009 ARe95A09 pKA1U5 NM_001901.2  
ATCCTGGACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCC
HKR078809 ARe97A09 pKA1U5 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR164980 ARi12H12 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR168430 ARi21B06 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR172178 ARi30H10 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR174948 ARi37G04 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR177609 ARi44A09 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR181280 ARi53D08 pGCAP10 NM_001901.2  
GACACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCT
HKR184545 ARi61G01 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR188405 ARi71A05 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR209213 ARiS023A13 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR209393 ARiS023I01 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR218146 ARiS045G02 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR219639 ARiS049B15 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR219688 ARiS049D16 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR222239 ARiS055J23 pGCAP10 NM_001901.2  
GACANNCANNAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCT
HKR235074 ARiS087L10 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR243866 ARiS109L02 pGCAP10 NM_001901.2  
GACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCGAC
HKR248963 ARiS122G19 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG
HKR260302 ARiS150M14 pGCAP10 NM_001901.2  
GACACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCT
HKR276504 ARiS191E08 pGCAP10 NM_001901.2  
GACACAACAACTCTTCCCCGCTGAGAGGAGACAGCCAGTGCGACTCCACCCTCCAGCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl