Prev. |  KEGG KO K04496 > 

RIKEN DNA Bank Human Resource - CTBP2

Gene ID NCBI Gene 1488 |  KEGG hsa:1488
Gene Symbol CTBP2
Protein Name C-terminal binding protein 2
Synonyms -
Featured content Notch signaling pathway (human)
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  CTBP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030206 IRAK075I14 pBluescriptR BC037900 NM_022802 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038966 W01A097G22 pENTR-TOPO IRAK075I14 BC037900 NM_022802  
HGE038968 W01A097G24 pENTR-TOPO IRAK075I14 BC037900 NM_022802 done
HGE038996 W01A097I04 pENTR-TOPO IRAK075I14 BC037900 NM_022802  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR331326 RBb28F06 pGCAP1 NM_001329.2  
GGATCATGGCAACGGGCTCGGGCGGGGAACGCGTGGCAGCGGCTGCAGCGGCGGCAGTTT
HKR371324 RBd28F04 pGCAP10 NM_001329.2  
GACCTCGCCTCCCGCCTAGCTCCTGCGCAGCCAGCGGGTACCGGGAGCTGCGGCCAGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl