Prev. |  KEGG KO K04496 > 

RIKEN DNA Bank Human Resource - CTBP1

Gene ID NCBI Gene 1487 |  KEGG hsa:1487
Gene Symbol CTBP1
Protein Name C-terminal binding protein 1
Synonyms BARS|HADDTS
Featured content Notch signaling pathway (human)
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  CTBP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086974 IRAL017H06 pOTB7 BC011655 NM_001328 Full
HGY099097 IRAL047M09 pOTB7 BC053320 NM_001012614 Full
HGY100213 IRAL050I21 pOTB7 BC064333 NM_001012614 Full/var
HGY103466 IRAL058L02 pOTB7 BC072021 NM_001328

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018971 W01A047H03 pENTR-TOPO IRAL017H06 BC011655 NM_001328  
HGE018973 W01A047H05 pENTR-TOPO IRAL017H06 BC011655 NM_001328  
HGE018977 W01A047H09 pENTR-TOPO IRAL017H06 BC011655 NM_001328  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066458 ARe66C10 pKA1U5 NM_001328.2  
GGTCGTCGGAGCGCGGCTCAGCGGCGCGGCGGAGANTCGGCACGGCGGCGGCCAGGCGCA
HKR378177 RBd45H09 pGCAP10 NM_001328.2  
GGCCCCNNTTNNGNCGTCGGAGCGCGGCTCAGCGGCGCGGCGGAGACTCGGCACGGCGGC
HKR393299 RBd83E03 pGCAP10 NM_001328.2  
GGGAGNNTCGGCACGGCGGCGGCCAGGCGCAGGCGGGCGGGCGGAGCAGCGGACGGCGCC
HKR406039 RBdS015B15 pGCAP10 NM_001328.2  
GGGCGCGNNNNANACTCNNCNNNNNNNCGGCCAGGNNCAGGCGGGCGGGCGGAGCAGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl