Prev. |  KEGG KO K14408 > 

RIKEN DNA Bank Human Resource - CSTF3

Gene ID NCBI Gene 1479 |  KEGG hsa:1479
Gene Symbol CSTF3
Protein Name cleavage stimulation factor subunit 3
Synonyms CSTF-77
Ortholog resources KEGG ortholog (KEGG orthology K14408) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04434 SEREX clone BRC-Co-42 #1 SEREX clone BRC-Co-42 #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007867 IRAK019L03 pCMV-SPORT6 BC010533 NM_001033506
HGX054364 IRAK135P04 pCMV-SPORT6 BC059948 NM_001033506 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE028205 W01A070I13 pENTR-TOPO IRAK135P04 BC059948 NM_001033506 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076051 ARe90C03 pKA1U5 NM_001326.2  
CGGAGTGGGCGGTGGCGATTGGTGTTGGCGGTCTGGCTCAGCTGGGCAGGGGGTAACTTT
HKR208324 ARiS020N12 pGCAP10 NM_001326.2  
ATATTTTAATTCATATCTGAGTGGGCGGTGGCGATTGGTGTTGGCGGTCTGGCTCAGCTG
HKR208332 ARiS020N20 pGCAP10 NM_001326.2  
GATATANCTGTCCAAGGTCTCCCCCAGCACTGAGGAGCTCGCCTGCTGCCCTCTTGCGCG
HKR474937 RBdS187F17 pGCAP10 NM_001326.2  
GACACCTCCTCCTCGGCCGGCAGGGGCGCAGCCATTTTAATTCATATCTGAGTGGGCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl