Prev. |  KEGG KO K13907 > 

RIKEN DNA Bank Human Resource - CSTB

Gene ID NCBI Gene 1476 |  KEGG hsa:1476
Gene Symbol CSTB
Protein Name cystatin B
Synonyms CPI-B|CST6|EPM1|EPM1A|PME|STFB|ULD
Ortholog resources KEGG ortholog (KEGG orthology K13907) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001361 IRAK003G17 pCMV-SPORT6 BC003370 NM_000100 Full
HGX007865 IRAK019L01 pCMV-SPORT6 BC010532 NM_000100 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037221 W01A093A21 pENTR-TOPO IRAK003G17 BC003370 NM_000100  
HGE037249 W01A093C01 pENTR-TOPO IRAK003G17 BC003370 NM_000100  
HGE037253 W01A093C05 pENTR-TOPO IRAK003G17 BC003370 NM_000100  
HGE037261 W01A093C13 pENTR-TOPO IRAK003G17 BC003370 NM_000100  
HGE037263 W01A093C15 pENTR-TOPO IRAK003G17 BC003370 NM_000100  
HGE037265 W01A093C17 pENTR-TOPO IRAK003G17 BC003370 NM_000100  
HGE037267 W01A093C19 pENTR-TOPO IRAK003G17 BC003370 NM_000100  
HGE044970 W01A112H02 pENTR-TOPO IRAK003G17 BC003370 NM_000100  
HGE044972 W01A112H04 pENTR-TOPO IRAK003G17 BC003370 NM_000100  
HGE044974 W01A112H06 pENTR-TOPO IRAK003G17 BC003370 NM_000100  
HGE044980 W01A112H12 pENTR-TOPO IRAK003G17 BC003370 NM_000100  
HGE035772 W01A089H04 pENTR-TOPO IRAK019L01 BC010532 NM_000100  
HGE035778 W01A089H10 pENTR-TOPO IRAK019L01 BC010532 NM_000100  
HGE035782 W01A089H14 pENTR-TOPO IRAK019L01 BC010532 NM_000100  
HGE035788 W01A089H20 pENTR-TOPO IRAK019L01 BC010532 NM_000100  
HGE035790 W01A089H22 pENTR-TOPO IRAK019L01 BC010532 NM_000100  
HGE035792 W01A089H24 pENTR-TOPO IRAK019L01 BC010532 NM_000100  

♦ W series clone contains a stop codon.

GNP_entry_W01A_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076827 ARe92B03 pKA1U5 NM_000100.2  
GGAGGAGCCGCCGCGNTCCCCTCGCCGAGTCCCCTCGCCAGATTCCCTCCGTCGCCGCCA
HKR077780 ARe94H12 pKA1U5 NM_000100.2  
GGCCGAGTCCCCTCGCCAGATTCCCTCCGTCGCCGCCAAGATGATGTGCGGGGCGCCCTC
HKR164034 ARi10B10 pGCAP10 NM_000100.2  
GGCGCGTCCCCTCGCCGAGTCCCCTCGCCAGATTCCCTCCGTCGCCGCCAAGATGATGTG
HKR173257 ARi33C09 pGCAP10 NM_000100.2  
GCCCTCGCCAGATTCCCTCCGTCGCCGCCAAGATGATGTGCGGGGCGCCCTCCGCCACGC
HKR218079 ARiS045D07 pGCAP10 NM_000100.2  
CNGCCGGCCGATGGCCNAGTCCCCTCGCCAGATTCCCTCCGTCGCCGCCAAGATGATGTG
HKR365275 RBd13D03 pGCAP10 NM_000100.2  
GGCCAGATTCCCTCCGTCGCCGCCAAGATGATGTGCGGGGCGCCCTCCGCCACGCAGCCG
HKR374879 RBd37D07 pGCAP10 NM_000100.2  
GCCCTTGGTTCCGCCCGCGCGTCACGTGACCCCAGCGCCTACTTGGGCTGAGGAGCCGCC
HKR376882 RBd42D10 pGCAP10 NM_000100.2  
GGCCGAGTCCCCTCGCCAGATTCCCTCCGTCGCCGCCAAGATGATGTGCGGGGCGCCCTC
HKR382171 RBd55H03 pGCAP10 NM_000100.2  
GCCAGCGCCTACTTGGGCTGAGGAGCCGCCGCGTCCCCTCGCCGNNNCCCCTCGCCAGAT
HKR388058 RBd70C10 pGCAP10 NM_000100.2  
GGTCGCCGCCAAGATGATGTGCGGGGCGCCCTCCGCCACGCAGCCGGCCACCGCCGAGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl