Prev. |  KEGG KO K13902 > 

RIKEN DNA Bank Human Resource - CST6

Gene ID NCBI Gene 1474 |  KEGG hsa:1474
Gene Symbol CST6
Protein Name cystatin E/M
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K13902) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097528 IRAL043N16 pOTB7 BC031334 NM_001323 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100842 M01C052B18 pDONR221 MGC15-H09 BC031334 NM_001323  
HGE100890 M01C052D18 pDONR221 MGC15-H09 BC031334 NM_001323  
HGE100938 M01C052F18 pDONR221 MGC15-H09 BC031334 NM_001323  
HGE100986 M01C052H18 pDONR221 MGC15-H09 BC031334 NM_001323  
HGE101034 M01C052J18 pDONR221 MGC15-H09 BC031334 NM_001323  
HGE101082 M01C052L18 pDONR221 MGC15-H09 BC031334 NM_001323  
HGE101130 M01C052N18 pDONR221 MGC15-H09 BC031334 NM_001323  
HGE101178 M01C052P18 pDONR221 MGC15-H09 BC031334 NM_001323  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR218370 ARiS045P10 pGCAP10 NM_001323.2  
GACTCGCGCTCCAGGAAGGTTGTCAGGCAGCGCTGAGCAGTAATGTGTCCTACTCACCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl