Prev. |  KEGG KO K13899 > 

RIKEN DNA Bank Human Resource - CST3

Gene ID NCBI Gene 1471 |  KEGG hsa:1471
Gene Symbol CST3
Protein Name cystatin C
Synonyms ARMD11|HEL-S-2
Ortholog resources KEGG ortholog (KEGG orthology K13899) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007962 IRAK019P02 pCMV-SPORT6 BC013083 NM_000099

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE040055 W01A100C07 pENTR-TOPO IRAK019P02 BC013083 NM_000099  
HGE040059 W01A100C11 pENTR-TOPO IRAK019P02 BC013083 NM_000099  
HGE040061 W01A100C13 pENTR-TOPO IRAK019P02 BC013083 NM_000099  
HGE040067 W01A100C19 pENTR-TOPO IRAK019P02 BC013083 NM_000099  
HGE040069 W01A100C21 pENTR-TOPO IRAK019P02 BC013083 NM_000099  
HGE050570 W01A126H02 pENTR-TOPO IRAK019P02 BC013083 NM_000099  
HGE050578 W01A126H10 pENTR-TOPO IRAK019P02 BC013083 NM_000099  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040811 ARe02A11 pKA1U5 NM_000099.2  
GGGCCTCGCGGGGCTCACGGCCTCGCCTCGGTATCGTAGCGGGTCCTCTCTATCTAGCTC
HKR045603 ARe14A03 pKA1U5 NM_000099.2  
GGAAAAGGGAGTGCAGGCCGCGGTGGGGTGGGGCGGCGAANGCCGGAAGGGATAAAACCG
HKR058009 ARe45A09 pKA1U5 NM_000099.2  
GGCTCACNGCCCTCGCCTCGGATATCGCAGCGGGTCCTCTCTATCTAGCTCCAGCCTCTC
HKR058011 ARe45A11 pKA1U5 NM_000099.2  
GGCCCCGCCCCAACCCGGGGCTCCGAGCCGGAGCCGAGTCTGCGCCTGGGGGAGGACCAT
HKR072074 ARe80D02 pKA1U5 NM_000099.2  
ATCCTGGTCACGGCCTCGCCTCGGTATCGCAGCGGGTCCTCTCTATCTAGCTCCAGCCTC
HKR073723 ARe84F03 pKA1U5 NM_000099.2  
GGGCCGGAAGGGATAAAACCGCAGTCGCCGGCCTCGCGGGGCTCACNGCCTCGCCTCGGT
HKR080898 ARf02E02 pKA1U5 NM_000099.2  
GGGAAGGGATAAAACCGCAGTCGCCGGCCTCGCGGGGCTCACNGCCTCGCCTCGGTATCG
HKR166546 ARi16G02 pGCAP10 NM_000099.2  
GGCTCACGGCCTCGCCTCGGTATCGCAGCGGGTCCTCTCTATCTAGCTCCAGCCTCTCGC
HKR166551 ARi16G07 pGCAP10 NM_000099.2  
AAACCGCAGTCGCCGGCCTCGCGGNTCCGGCCTCGCTCGNNNTCNCAGCGGGTCCTCTCT
HKR182903 ARi57E07 pGCAP10 NM_000099.2  
GACGGCCTCGCCTCGGTATCGCAGCGGGTCCTCTCTATCTAGCTCCAGCCTCTCGCCTGC
HKR183300 ARi58E04 pGCAP10 NM_000099.2  
GACGGCCTCGCCTCGGTATCGCAGCGGGTCCTCTCTATCTAGCTCCAGCCTCTCGCCTGC
HKR203552 ARiS008O16 pGCAP10 NM_000099.2  
GACGGCCTCGCCTCGGTATCGCAGCGGGTCCTCTCTATCTAGCTCCAGCCTCTCGCCTGC
HKR243860 ARiS109K20 pGCAP10 NM_000099.2  
GACGGCCTCGCCTCGGTATCGCAGCGGGTCCTCTCTATCTAGCTCCAGCCTCTCGCCTGC
HKR264571 ARiS161H03 pGCAP10 NM_000099.2  
GACGGCCTCNCCTCGGTATCGCAGCGGGTCCTCTCTATCTAGCTCCAGCCTCTCGCCTGC
HKR279257 ARiS198C09 pGCAP10 NM_000099.2  
GACGGCCTCGCCTCGGTATCGCAGCGGGTCCTCTCTATCTAGCTCCAGCCTCTCGCCTGC
HKR367254 RBd18C06 pGCAP10 NM_000099.2  
GGGGGCGGCGAAGGCCGGAAGGGATAAAACCGCAGTCGCCGGCCTCGCGGGGCTCACAGC
HKR391235 RBd78B11 pGCAP10 NM_000099.2  
GAGCCCCGGTGTGCGGTGCATACACCCCCACCTCCTGCAATAAAATAGTAGCATCGGCAA
HKR403116 RBdS007N04 pGCAP10 NM_000099.2  
GGAAGGCCGGAAGGGATAAAACCGCAGTCGCCGGCCTCGCGGGGCTCACGGCCTCGCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl