Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CSNK2B

Gene ID (NCBI) 1460
Gene Symbol CSNK2B
Protein Name casein kinase 2 beta
Synonyms CK2B|CK2N|CSK2B|Ckb1|Ckb2|G5A
Databases KEGG hsa:1460 |  NCBI Gene 1460
Featured content Wnt signaling pathway (human)
Featured content NF-kappa B signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03115)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049380 ARe23H12 pKA1U5 NM_001320.5  
GCCTCCCTAATTTCCACTCCCCCCACCCCACTTCGCCTGCCGCGGTCGGGTCCGCGGCCT
HKR074431 ARe86B07 pKA1U5 NM_001320.5  
GACCCTCCCTAATTTCCACTCCCCCCACCCCACTTCGCCTGCCGCGGTCGGGTCCGCGGC
HKR076969 ARe92H01 pKA1U5 NM_001320.5  
AGGGCCTGCCGCGGTCGGGTCCGCGGCCTGCGCTGTAGCGGTCGCCGCCGTTCCCTGGAA
HKR171352 ARi28G08 pGCAP10 NM_001320.5  
CGGCCGGCCGATGCCCACCCCACTTCGCCTGCCGCGGTCGGGTCCGCGGCCTGCGCTGTA
HKR174497 ARi36E01 pGCAP10 NM_001320.5  
GCCCCACCCCACTTCGCCTGCCGCGGTCGGGTCCGCGGCCTGCGCTGTAGCGGTCGCCGC
HKR174806 ARi37A06 pGCAP10 NM_001320.5  
GCCCCCACCCCACTTCGCCTGCCGCGGTCGGGTCCGCGGCCTGCGCTGTAGCGGTCGCCG
HKR186550 ARi66G06 pGCAP10 NM_001320.5  
GCCCCACCCCACTTCGCCTGCCGCGGTCGGGTCCGCGGCCTGCGCTGTAGCGGTCGCCGC
HKR235201 ARiS088A01 pGCAP10 NM_001320.5  
GACTCCCCCCACCCCACTTCGCCTGCCGCGGTCGGGTCCGCGGCCTGCGCTGTAGCGGTC
HKR264733 ARiS161N21 pGCAP10 NM_001320.5  
GCCCCCNCCCNANTTCNCCTGCCGCGGTCGGGTCCGCGGCCTGCGCTGTAGCGGTCGCCG
HKR328528 RBb21F08 pKA1U5 NM_001320.5  
HKR360827 RBd02B03 pGCAP10 NM_001320.5  
GGCGGAAAACCCCGCGCGAGCAAGATGGCCACCACCAAGCGCGTCTTGTACGTGGGTGGA
HKR399225 RBd98B01 pGCAP10 NM_001320.5  
GCTCCCTAATTTCCACTCCCCCCACCCCACTTCGCCTGCCGCGGTCGGGTCCGCGGCCTG
HKR405442 RBdS013K02 pGCAP10 NM_001320.5  
GAATTTCCACTCCCCCCACCCCACTTCGCCTGCCGCGGTCGGGTCCGCGGCCTGCGCTGT
HKR416257 RBdS040K17 pGCAP10 NM_001320.5  
GGCCTGCCGCGGTCGGGTCCGCGGCCTGCGCTGTAGCGGTCGCCGCCGTTCCCTGGAAGT
HKR428355 RBdS070O19 pGCAP10 NM_001320.5  
GTCCACTCCCCCCACCCCACTTCGCCTGCCGCGGTCGGGTCCGCGGCCTGCGCTGNAGCG
HKR442327 RBdS105N15 pGCAP10 NM_001320.5  
GGTCCGCGGCCTGCGCTGTAGCGGTCGCCGCCGTTCCCTGGAAGTAGCAACTTCCCTACC
HKR471095 RBdS177M07 pGCAP10 NM_001320.5  
GGCCTGCCGCGGTCGGGTCCGCGGCCTGCGCTGTAGCGGTCGCCGCCGTTCCCTGGAAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl