Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CSNK2A1

Gene ID (NCBI) 1457
Gene Symbol CSNK2A1
Protein Name casein kinase 2 alpha 1
Synonyms CK2A1|CKII|CSNK2A3|Cka1|Cka2|OCNDS
Databases KEGG hsa:1457 |  NCBI Gene 1457
Featured content Wnt signaling pathway (human)
Featured content NF-kappa B signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03097)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07483 pGL4-phCSNK2A1 Promoter collection, Human CSNK2A1 promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX046013 IRAK115A13 pCMV-SPORT6 BC053532 NM_177560 Full
HGX069705 IRAK174E09 pCMV-SPORT6 BC071167 NM_177560 Full
HGY090482 IRAL026D10 pOTB7 BC011668 NM_177560 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR218248 ARiS045K08 pGCAP10 NM_001895.3  
GATATNNTCTGTGTGAGCNNAGGNGAGAGCGGCCGCCNNNNCTGCNGCTTCNACCACNTT
HKR336436 RBb41B12 pGCAP1 NM_001895.3  
GAGCCTCGCTCTGGTCCCTGCGGCTGGCGGCCGAGCCGTGTGTCTCCTCCTCCATCGCCG
HKR346148 RBb65G04 pGCAP1 NM_001895.3  
TTGGTGTCTCCTCCTCCATCGCCGCCATATTGTCTGTGTGAGCAGAGGGGAGAGCGGCCG
HKR462749 RBdS156O13 pGCAP10 NM_001895.3  
TTGNTGTCTCCTCCTCCATCGCCGCCATATTGTCTGTGTGAGCAGAGGGGAGAGCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl