DNA Bank Top |  KEGG KO K03097 > 

RIKEN DNA Bank Human Resource - CSNK2A1

Gene ID NCBI Gene 1457 |  KEGG hsa:1457
Gene Symbol CSNK2A1
Protein Name casein kinase 2 alpha 1
Synonyms CK2A1|CKII|Cka1|Cka2|OCNDS
Featured content Wnt signaling pathway (human)
Featured content NF-kappa B signaling pathway (human)
Featured content Mitophagy - human

Link

Ortholog resource in our bank

  CSNK2A1

External database

human CSNK2A1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07483 pGL4-phCSNK2A1 Promoter collection, Human CSNK2A1 promoter    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046013 IRAK115A13 pCMV-SPORT6 BC053532 NM_177560 Full
HGX069705 IRAK174E09 pCMV-SPORT6 BC071167 NM_177560 Full
HGY090482 IRAL026D10 pOTB7 BC011668 NM_177560 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218248 ARiS045K08 pGCAP10 NM_001895.3  
GATATNNTCTGTGTGAGCNNAGGNGAGAGCGGCCGCCNNNNCTGCNGCTTCNACCACNTT
HKR336436 RBb41B12 pGCAP1 NM_001895.3  
GAGCCTCGCTCTGGTCCCTGCGGCTGGCGGCCGAGCCGTGTGTCTCCTCCTCCATCGCCG
HKR346148 RBb65G04 pGCAP1 NM_001895.3  
TTGGTGTCTCCTCCTCCATCGCCGCCATATTGTCTGTGTGAGCAGAGGGGAGAGCGGCCG
HKR462749 RBdS156O13 pGCAP10 NM_001895.3  
TTGNTGTCTCCTCCTCCATCGCCGCCATATTGTCTGTGTGAGCAGAGGGGAGAGCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.26

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl