Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CSNK1G2

Gene ID (NCBI) 1455
Gene Symbol CSNK1G2
Protein Name casein kinase 1, gamma 2
Synonyms CK1g2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Hedgehog signaling (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008330 IRAK020N18 pCMV-SPORT6 BC020972 NM_001319
HGY081278 IRAL003D06 pOTB7 BC018693 NM_001319 Full/var
HGY084166 IRAL010G22 pOTB7 BC018699 NM_001319 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006522 W01A016F02 pENTR-TOPO IRAK020N18 BC020972 NM_001319  
HGE006530 W01A016F10 pENTR-TOPO IRAL003D06 BC018699 NM_001319  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162125 ARi05F05 pGCAP10 NM_001319.6  
GGTAAGGNGTGCGGGCCCCGGAGCGGGCGCGGCGGAGCGCGGCTAGCCCGGCGCCTCCCG
HKR396858 RBd92C10 pGCAP10 NM_001319.6  
ACGGCGGCGGAGCGCGGCGAGCCCGGCGCCTCCCGTCCCGAACATGCGGAGGCCGGCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl