DNA Bank Top |  KEGG KO K08960 > 

RIKEN DNA Bank Human Resource - CSNK1E

Gene ID NCBI Gene 1454 |  KEGG hsa:1454
Gene Symbol CSNK1E
Protein Name casein kinase 1 epsilon
Synonyms CKIe|CKIepsilon|HCKIE
Featured content Circadian clock (human)
Featured content Hippo signaling (human)
Featured content Hedgehog signaling (human)
Featured content Wnt signaling pathway (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.

Link

Ortholog resource in our bank

  CSNK1E

External database

human CSNK1E

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19317 pFN21A_Halo_CK1epsilon_K38R Expresion vector of human CK1 epsilon kinase-dead mutant (K38R) tagged with Halo at N-terminus.    
RDB19316 pFN21A_Halo_CK1epsilon Expresion vector of human CK1 epsilon tagged with Halo at N-terminus.    
RDB05180 pAxCALNLhCSNK1E (reverse) Shuttle vector to generate rAd harboring human CSNK1E (reverse)    
RDB05179 pAxCALNLhCSNK1E (forward) Shuttle vector to generate rAd harboring human CSNK1E (forward)    
RDB04681 pAxCALNLhCSNK1E(forward) Shuttle vector to generate rAd expressing human CSNK1E    
RDB04085 pAxCALNLhCSNK1E (reverse) Shuttle vector to generate rAd harboring human CSNK1E (reverse)    
RDB03500 pAxCALNLhCSNK1E (forward) Shuttle vector to generate rAd harboring human CSNK1E (forward)    
RDB03171 casein kinaseI epsilon/pBluescript Plasmid clone of human casein kinase I epsilon cDNA    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085928 IRAL014N16 pOTB7 BC006490 NM_152221 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR328412 RBb21A12 pKA1U5 NM_152221.2  
GGGAGCGCGGCGGCGGCGGCGGCGGCGGCGGCTGGNCCGGGAGAGGCTGGCGCGCCGGGC
HKR369354 RBd23G10 pGCAP10 NM_152221.2  
GATAGGGCGTGGCGCGGGGCCGCGGAGTCGGGTGAGGCGGCGGCGGCTGCGGCGGTGGGG
HKR430108 RBdS075E12 pGCAP10 NM_152221.2  
GAGAGCCANAGCCCGGCCGGGNCCNANCGNAGCGNGNCGGCNGNNGCGGCGGCGGCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl