Prev. |  KEGG KO K08957 > 

RIKEN DNA Bank Human Resource - CSNK1A1

Gene ID NCBI Gene 1452 |  KEGG hsa:1452
Gene Symbol CSNK1A1
Protein Name casein kinase 1 alpha 1
Synonyms CK1|CK1a|CKIa|HEL-S-77p|HLCDGP1|PRO2975
Featured content Hedgehog signaling (human)
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  CSNK1A1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19303 pFN21A_Halo_CK1alpha Expresion vector of human CK1 alpha tagged with Halo at N-terminus.
RDB19304 pFN21A_Halo_CK1alpha_K46R Expresion vector of human CK1 alpha kinase-dead mutant (K46R) tagged with Halo at N-terminus.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080583 IRAL001H15 pOTB7 BC008717 NM_001892 Full/var
HGY088405 IRAL021A05 pDNR-LIB BC005905
HGY090089 IRAL025D17 pOTB7 BC021971 NM_001025105 Partial/var
HGY090307 IRAL025M19 pOTB7 BC025371 NM_001025105 Partial/var
HGY096781 IRAL041P21 pDNR-LIB BC040473 NM_001892

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005788 W01A014H20 pENTR-TOPO IRAL001H15 BC008717 NM_001892  
HGE005792 W01A014H24 pENTR-TOPO IRAL001H15 BC008717 NM_001892  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR470940 RBdS177F20 pGCAP10 NM_001892.4  
TAAGATGGCGTCGTCCGCGGAGTGACAGGGGTCCCTCTGGGCCGGAGCCGGCGGCAGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl