Prev. |  KEGG KO K05453 > 

RIKEN DNA Bank Human Resource - CSF1

Gene ID NCBI Gene 1435 |  KEGG hsa:1435
Gene Symbol CSF1
Protein Name colony stimulating factor 1
Synonyms CSF-1|MCSF
Ortholog resources KEGG ortholog (KEGG orthology K05453) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01524 pCAhMCSF Expression vector of human M-CSF
RDB01525 pAxCAhMCSF Shuttle vector to generate rAd expressing human M-CSF
RDB01563 AxCAhMCSF Recombinant adenovirus expressing human M-CSF gene
RDB01453 pMFGhMCSF Recombinant retrovirus vector .Human M-CSF cDNA expression

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096140 IRAL040F20 pOTB7 BC021117 NM_172212 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186051 ARi65C03 pGCAP10 NM_000757.4  
TGGAGGCTCGGCCCGGGGAAAGTGAAAGTTTGCCTGGGTCCTCTCGGCGCCAGAGCCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl