Prev. |  KEGG KO K18423 > 

RIKEN DNA Bank Human Resource - CSE1L

Gene ID NCBI Gene 1434 |  KEGG hsa:1434
Gene Symbol CSE1L
Protein Name chromosome segregation 1 like
Synonyms CAS|CSE1|XPO2
Ortholog resources KEGG ortholog (KEGG orthology K18423) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR222258 ARiS055K18 pGCAP10 NM_001316.2  
GGCCGGGGTTTGAATGTGAGGCGGAGCGGCGGCAGGAGCGGGTAGTGCCAGCTACGGTCC
HKR368049 RBd20C01 pGCAP10 NM_001316.2  
GGTGAGGCGGAGCGGCGGCAGGAGCGGGTAGTGCCAGCTACGGTCCGCGGCTGGGGTTCC
HKR432568 RBdS081G24 pGCAP10 NM_001316.2  
GNNNAGGCGGAGCGNCGGCAGGAGCGGGTAGTGCCAGCTACGGTCCGCGGCTGGGGTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl