Prev. |  KEGG KO K04441 > 

RIKEN DNA Bank Human Resource - MAPK14

Gene ID NCBI Gene 1432 |  KEGG hsa:1432
Gene Symbol MAPK14
Protein Name mitogen-activated protein kinase 14
Synonyms CSBP|CSBP1|CSBP2|CSPB1|EXIP|Mxi2|PRKM14|PRKM15|RK|SAPK2A|p38|p38ALPHA
Featured content MAP kinases (human)
Featured content MAPK p38 inhibitor screening
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content T cell receptor signaling pathway (human)
Featured content Amyotrophic lateral sclerosis (ALS) - human
Featured content SARS-CoV-2 relevant human genes
Ortholog resource in our bank

  MAPK14

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB08165 pGEM-hp38alpha Plasmid vector of human p38alpha MAPK cDNA
RDB08166 pcDNA3Flag-hp38 Expression vector of human p38alpha MAPK cDNA, FLAG-tagged
RDB08167 pcDNA3HA-hp38 Expression vector of human p38alpha MAPK cDNA, HA-tagged
RDB08168 pcDNA3Flag-hp38AF Expression vector of human p38alpha MAPK cDNA, constitutive inactive form, FLAG-tagged
RDB08169 pcDNA3Flag-hp38K53A Expression vector of human p38alpha MAPK cDNA, kinase dead mutant, FLAG-tagged
RDB08170 pZeoSV2Flag-hp38 Expression vector of human p38alpha MAPK cDNA, FLAG-tagged
RDB08171 pGEX-hp38 Bacterial expression vector of human p38alpha MAPK cDNA, GST-tagged
RDB08172 pRSET-hp38 Bacterial expression vector of human p38alpha MAPK cDNA, His6-tagged
RDB08173 pRSET-hp38K53A Bacterial expression vector of human p38alpha MAPK cDNA, kinase dead mutant, His6-tagged
RDB08174 pRSET-hp38T106M Bacterial expression vector of human p38alpha MAPK cDNA, inhibitor-insensitive T106M mutant, His6-tagged.
RDB08175 pRSET-hp38Y323F Bacterial expression vector of human p38alpha MAPK cDNA, Y323F mutant, His6-tagged
RDB08176 pRSET-hp38AF Bacterial expression vector of human p38alpha MAPK cDNA, constitutive inactive form, His6-tagged
RDB08177 pRSET-hp38T180A/Y323F Bacterial expression vector of human p38alpha MAPK cDNA, T180A/Y323F mutant, His6-tagged
RDB08178 pRSET-GST-hp38 Bacterial expression vector of human p38alpha MAPK cDNA, GST-tagged
RDB08179 pEGFP-hp38alpha Expression vector of human p38alpha MAPK cDNA, FLAG- and EGFP-tagged
RDB08180 pcDNA3Flag-hCSBP1 Expression vector of human p38alpha MAPK cDNA, alternatively spliced, FLAG-tagged
RDB08181 pGEM-hExip Plasmid vector of human p38alpha MAPK splicing variant cDNA
RDB08182 pcDNA3Flag-hExip Expression vector of human p38alpha MAPK splicing variant cDNA, FLAG-tagged
RDB08183 pcDNA3HA-hExip Plasmid vector of human p38alpha MAPK splicing variant cDNA, HA-tagged
RDB08184 pcDNA3Flag-hExipAF Plasmid vector of human p38alpha MAPK splicing variant cDNA, FLAG-tagged
RDB08185 pcDNA3Flag-hExipK53A Plasmid vector of human p38alpha MAPK splicing variant cDNA, kinase dead K53A mutant, FLAG-tagged
RDB08186 pcDNA3Flag-hExipK53R Plasmid vector of human p38alpha MAPK splicing variant cDNA, K53R mutant, FLAG-tagged
RDB08187 pZeoSV2Flag-hExip Plasmid vector of human p38alpha MAPK splicing variant cDNA, FLAG-tagged
RDB08188 pEGFP-hExip Plasmid vector of human p38alpha MAPK splicing variant cDNA, FLAG- and EGFP-tagged

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020031 IRAK050B07 pCMV-SPORT6 BC031574 NM_139012 Full
HGY083017 IRAL007J01 pOTB7 BC000092 NM_139012 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE029455 W01A073K15 pENTR-TOPO IRAK050B07 BC031574 NM_139012  
HGE029463 W01A073K23 pENTR-TOPO IRAK050B07 BC031574 NM_139012  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064925 ARe62F05 pKA1U5 NM_001315.2  
GAGCGGGCGCAGCAGCTGGAACGGGAGTACTGCGACGCAGCCCGGAGTCGGCCTTGTAGG
HKR171609 ARi29A09 pGCAP10 NM_001315.2  
GGGAGCCTTAGCGGGCGCAGCAGCTGGAACGGGAGTACTGCGACGCAGCCCGGAGTCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.18

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl