Prev. |  KEGG KO K01647 > 

RIKEN DNA Bank Human Resource - CS

Gene ID NCBI Gene 1431 |  KEGG hsa:1431
Gene Symbol CS
Protein Name citrate synthase
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K01647) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083028 IRAL007J12 pOTB7 BC000105 NM_198324 Full
HGY090906 IRAL027E10 pOTB7 BC010106 NM_198324 Full
HGY103525 IRAL058N13 pOTB7 BC072016 NM_198324 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072880 ARe82D08 pKA1U5 NM_004077.2  
GGCCTCCTTTCAACCTTGTCAACCCGTCGGCGCGGCCTCTGGTGCAGCGGCGGCGGCTCC
HKR178807 ARi47A07 pGCAP10 NM_004077.2  
GGGGCTGGGCGCCGCCGCCGGTTCGTCTACTCTTTCCTTCAGCCGCCTCCTTTCAACCTT
HKR183282 ARi58D10 pGCAP10 NM_004077.2  
GGCGCGCCCGGGCTCCTGCAGGCGGNCGCTGTGCGCGCCGCGATCCGGTACGTGGCNTCC
HKR218174 ARiS045H06 pGCAP10 NM_004077.2  
GCCTTCAGCCGCCTCCTTTCAACCTTGTCAACCCGTCGGCGCGGCCTCTGGTGCAGCGGC
HKR344005 RBb60A05 pGCAP1 NM_004077.2  
GGTGCCGCGCTTCCCTTCTGGCTCCTGGGGGTGAAGTGCACGCCGCCCGCCCTCGGCCCG
HKR362812 RBd07A12 pGCAP10 NM_004077.2  
GGGGCTGGGCGCCGCCGCCGGTTCGTCTACTCTTTCCTTCAGCCGCCTCCTTTCAACCTT
HKR381751 RBd54G07 pGCAP10 NM_004077.2  
GAGCCGCCTCCTTTCAACCTTGTCAACCCGTCGGCGCGGCCTCTNNTGCAGCGGCGGCGG
HKR409146 RBdS022O10 pGCAP10 NM_004077.2  
GCTTTTTCCTTCAGCCGCCTCCTTTCAACCTTGTCAACCCGTCGGCGCGGCCTCTGGTGC
HKR444099 RBdS110E03 pGCAP10 NM_004077.2  
GTCTTTCCTTCAGCCGCCTCCTTTCAACCTTGTCAACCCGTCGGCGCGGCCTCTGGTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl