Prev. |  KEGG KO K09542 > 

RIKEN DNA Bank Human Resource - CRYAB

Gene ID NCBI Gene 1410 |  KEGG hsa:1410
Gene Symbol CRYAB
Protein Name crystallin alpha B
Synonyms CMD1II|CRYA2|CTPP2|CTRCT16|HEL-S-101|HSPB5|MFM2
Ortholog resources KEGG ortholog (KEGG orthology K09542) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086631 IRAL016J15 pDNR-LIB BC007008 NM_001885 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE013332 W01A033F12 pENTR-TOPO IRAL016J15 BC007008 NM_001885  
HGE013334 W01A033F14 pENTR-TOPO IRAL016J15 BC007008 NM_001885  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043210 ARe08A10 pKA1U5 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTTCACACTCNCCATAGACCACCNTGGTACATC
HKR043298 ARe08E02 pKA1U5 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR043327 ARe08F07 pKA1U5 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACTTAGCCACCATGGACATCGCCATC
HKR045331 ARe13F11 pKA1U5 NM_001885.1  
GGGAGCTGACCAGCCAGCTGACCCCTCACACTCCCCTAGCCACCATGGACATCGCCATCC
HKR047302 ARe18E06 pKA1U5 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR048178 ARe20H10 pKA1U5 NM_001885.1  
GACACTCACCTAGCCACCATGGACATCGCCATCCACCACCCCTGGATCCGCCGCCCCTT
HKR048804 ARe22A04 pKA1U5 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR052173 ARe30H05 pKA1U5 NM_001885.1  
GTGGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGTACATCG
HKR052174 ARe30H06 pKA1U5 NM_001885.1  
GAGCTTCACAAGACTGCATATATAAGGGGCTGGCTGTAGCTGCAGCTGAAGGAGCTGACC
HKR053674 ARe34D02 pKA1U5 NM_001885.1  
GACACCCAGGCCCGGCAAAGAGCAGGATATCAGCACTGCAAGCACCAAGTGTGTCTTGAG
HKR055775 ARe39H07 pKA1U5 NM_001885.1  
ATCCTGGGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACA
HKR056053 ARe40C05 pKA1U5 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCATAGCCACCATGGTACATCGC
HKR056834 ARe42B10 pKA1U5 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR057258 ARe43C10 pKA1U5 NM_001885.1  
ATGGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGC
HKR058875 ARe47D03 pKA1U5 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCNCCTAGCCACCATGGACATCGCCA
HKR063679 ARe59D07 pKA1U5 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR070425 ARe76B01 pKA1U5 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACTTAGCCACCATGGACATCGCCATC
HKR077632 ARe94B08 pKA1U5 NM_001885.1  
GGCATATATAAGGGGCTGGCTGCTAGCTGCAGCCTGAAGGAGCTGACCAGCCAGCTGTAC
HKR077722 ARe94F02 pKA1U5 NM_001885.1  
GGAAGGAGCTGAACCAGCCAGCTGACCCCTCACACCTCACCTAGCCACCATGGTACATCG
HKR080476 ARf01D04 pKA1U5 NM_001885.1  
TACAAGTCTCCATGAACTGCTGGTGAGCTAGGATAATAAAACCCCTGACATCACCATTCC
HKR080505 ARf01E09 pKA1U5 NM_001885.1  
GGGACAAGGAGGCACACCCAGGCCGGCAAAGAGCAGGTATCAGCACTGCAAGCACCAAGT
HKR080972 ARf02H04 pKA1U5 NM_001885.1  
GGGAGCTGACCAGCCAGCTGACCCCTCACACATCACCTTAGCCACCATGGACATCGCCAT
HKR082810 ARf07A10 pKA1U5 NM_001885.1  
GGGAGCTGACCAGCCAGCTGACCCCTCACACATCACCTAGCCACCATGGACATCGCCATC
HKR082948 ARf07G04 pKA1U5 NM_001885.1  
GGGAGCTGACCAGCCAGCTGACCCCTCACACTCNCCTTNNACACCATGGACATCGCCATC
HKR160503 ARi01E07 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR161628 ARi04B04 pGCAP10 NM_001885.1  
GACACTCACCTAGCCACCATGGACATCGCCATCCACCACCCCTGGATCCGCCGCCCTTCT
HKR162132 ARi05F12 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR162149 ARi05G05 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR162454 ARi06C06 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR162575 ARi06H07 pGCAP10 NM_001885.1  
HKR162925 ARi07F05 pGCAP10 NM_001885.1  
GCCCACTCCCCCAGCCGCCTCTTTGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGAT
HKR163725 ARi09F05 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR163774 ARi09H06 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR166477 ARi16D05 pGCAP10 NM_001885.1  
GAGGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR167605 ARi19A05 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR168051 ARi20C03 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR168124 ARi20F04 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR168810 ARi22A10 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR169371 ARi23H03 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCNACCATGGACATCGCCA
HKR169772 ARi24H04 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR170025 ARi25B01 pGCAP10 NM_001885.1  
TAGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCC
HKR170027 ARi25B03 pGCAP10 NM_001885.1  
GGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATCC
HKR170548 ARi26G04 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR172531 ARi31F11 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR172545 ARi31G01 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR174804 ARi37A04 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR175633 ARi39B09 pGCAP10 NM_001885.1  
AGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATCC
HKR176173 ARi40H05 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR176522 ARi41F02 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR178425 ARi46B01 pGCAP10 NM_001885.1  
GaGGaGCTGAccaGccAGCTGAcCCCTCACACTCACCTAGCCACCATGGACATCGCCATCC
HKR178976 ARi47H08 pGCAP10 NM_001885.1  
CGGCCGGCCGATGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCAT
HKR179254 ARi48C06 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR179380 ARi48H12 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR179659 ARi49C11 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR179771 ARi49H03 pGCAP10 NM_001885.1  
TAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR180107 ARi50E11 pGCAP10 NM_001885.1  
GGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATCC
HKR180433 ARi51B09 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR180573 ARi51H05 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR180859 ARi52C11 pGCAP10 NM_001885.1  
TTGAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR180928 ARi52F08 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR180952 ARi52G08 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR181297 ARi53E01 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR181656 ARi54C08 pGCAP10 NM_001885.1  
GGGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCC
HKR183257 ARi58C09 pGCAP10 NM_001885.1  
GAAGACCATGACAAGTCACTGGCCGGCTCAGACGTGTTTGTGTCTCTCTTTTCTTAGCTC
HKR183284 ARi58D12 pGCAP10 NM_001885.1  
GACACCCAGGCCGGCAAAGAGCNNGTATCAGCACTGCAAGCACCAAGTGTGTCTTGAGCT
HKR183651 ARi59C03 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR183778 ARi59H10 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR184977 ARi62H09 pGCAP10 NM_001885.1  
GAAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR186108 ARi65E12 pGCAP10 NM_001885.1  
CGGCCGGCCGATTGAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCAT
HKR186130 ARi65F10 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR186404 ARi66A04 pGCAP10 NM_001885.1  
GGTAGCTGCAGCTGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCA
HKR186532 ARi66F12 pGCAP10 NM_001885.1  
GGCTTCACAAGACTGCATATATAAGGGGCTGGCTGTAGCTGCAGCTGAAGGAGCTGACCA
HKR186849 ARi67C01 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR186947 ARi67G03 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR188434 ARi71B10 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR203467 ARiS008L03 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR203553 ARiS008O17 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR205209 ARiS013A09 pGCAP10 NM_001885.1  
GGCTTCNCAAGACTGCATATATAAGGGGCTGGCTGTAGCTGCAGCTGAAGGAGCTGACCA
HKR205235 ARiS013B11 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR205318 ARiS013E22 pGCAP10 NM_001885.1  
TGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR208109 ARiS020E13 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR208129 ARiS020F09 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR208218 ARiS020J02 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR208269 ARiS020L05 pGCAP10 NM_001885.1  
TGGAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR209436 ARiS023J20 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR209440 ARiS023J24 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR209495 ARiS023M07 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR209523 ARiS023N11 pGCAP10 NM_001885.1  
CAGGAGCTGNCCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR209545 ARiS023O09 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR209554 ARiS023O18 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR218237 ARiS045J21 pGCAP10 NM_001885.1  
GAGGANCTGACCAGCCNGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR219649 ARiS049C01 pGCAP10 NM_001885.1  
gGGAGCTGACCAGCCaGCTGACCCCTCACACTCaCCTAGCCACCATGGACATCGCCaTCC
HKR219655 ARiS049C07 pGCAP10 NM_001885.1  
TAaAGAAGGAGCTGACCAgCCagCTGACCCCTCACACTCACCTAGCCACCATGGACATCG
HKR222136 ARiS055F16 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR222198 ARiS055I06 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR234071 ARiS085C23 pGCAP10 NM_001885.1  
CGGCCGGCCGATGGGaGCtGaCCaGCCaGctGaCCCCTCaCaCTCaCCTAGCCACCAtGG
HKR234081 ARiS085D09 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR234276 ARiS085L12 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR234281 ARiS085L17 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR235070 ARiS087L06 pGCAP10 NM_001885.1  
GACACTCACCTAGCCACCATGGACATCGCCATCCACCACCCCTGGATCCGCCGCCCCTTC
HKR238497 ARiS096E01 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR238511 ARiS096E15 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR238595 ARiS096I03 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR243615 ARiS109A15 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR243654 ARiS109C06 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR243771 ARiS109H03 pGCAP10 NM_001885.1  
AGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATCC
HKR247244 ARiS118B20 pGCAP10 NM_001885.1  
CGGCCGGCCGATGACAAGACTGCATATATAAGGGGCTGGCTGTAGCTGCAGCTGAAGGAG
HKR247487 ARiS118L23 pGCAP10 NM_001885.1  
GGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATCC
HKR247538 ARiS118O02 pGCAP10 NM_001885.1  
AGCTTCACAAGACTGCATATATAAGGGGCTGGCTGTAGCTGCAGCTGAAGGAGCTGACCA
HKR247566 ARiS118P06 pGCAP10 NM_001885.1  
GGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATCC
HKR248891 ARiS122D19 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR260351 ARiS150O15 pGCAP10 NM_001885.1  
GAANGAGNTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR264516 ARiS161E20 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR264543 ARiS161F23 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR264566 ARiS161G22 pGCAP10 NM_001885.1  
GAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCAT
HKR264575 ARiS161H07 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCNNCNGNCCCCTNANANTCACCTAGCCACCATGGACATCGCCATC
HKR264697 ARiS161M09 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR264740 ARiS161O04 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR276470 ARiS191C22 pGCAP10 NM_001885.1  
GCTCTTTTCTTAGCTCAGTGAGTACTGGGTATGTGTCACATTGCCAAATCCCGGATCACA
HKR276528 ARiS191F08 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR276747 ARiS191O11 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR277698 ARiS194E02 pGCAP10 NM_001885.1  
GAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR277737 ARiS194F17 pGCAP10 NM_001885.1  
TTAAGGGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGC
HKR277822 ARiS194J06 pGCAP10 NM_001885.1  
GAGGANCTGACCAGCCCNCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATC
HKR279329 ARiS198F09 pGCAP10 NM_001885.1  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR279396 ARiS198I04 pGCAP10 NM_001885.1  
GGAGTACTGGGTATGTGTCACATTGCCAAATCCCGGATCACAAGTCTCCATGAACTGCTG
HKR279482 ARiS198L18 pGCAP10 NM_001885.1  
GAGAAGCTTCACAAGACTGCATATATAAGGGGCTGGCTGTAGCTGCAGCTGAAGGAGCTG
HKR279514 ARiS198N02 pGCAP10 NM_001885.1  
GGCTTCACAAGACTGCATATATAAGGGGCTGGCTGTAGCTGCAGCTGAAGGAGCTGACCA
HKR279548 ARiS198O12 pGCAP10 NM_001885.1  
GGGAGCNGNCCAGCCAGCNGACCCCTCACACTCACCTAGCCACCATGGACATCGCCATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl