Prev. |  KEGG KO K02295 > 

RIKEN DNA Bank Human Resource - CRY1

Gene ID NCBI Gene 1407 |  KEGG hsa:1407
Gene Symbol CRY1
Protein Name cryptochrome circadian regulator 1
Synonyms DSPD|PHLL1
Featured content Circadian clock (human)
Ortholog resource in our bank

  CRY1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025713 IRAK064E17 pCMV-SPORT6 BC030519 NM_004075 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE039138 W01A097O02 pENTR-TOPO IRAK064E17 BC030519 NM_004075  
HGE039140 W01A097O04 pENTR-TOPO IRAK064E17 BC030519 NM_004075 done
HGE039142 W01A097O06 pENTR-TOPO IRAK064E17 BC030519 NM_004075  
HGE039148 W01A097O12 pENTR-TOPO IRAK064E17 BC030519 NM_004075  
HGE039152 W01A097O16 pENTR-TOPO IRAK064E17 BC030519 NM_004075  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041708 ARe04E12 pKA1U5 NM_004075.3  
GAGAGTCACCCGGGCAGCCTCGGGACCGGTCACCGGCCGGCAACCGTCCAGCGGCCTCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl