Prev. |  KEGG KO K09337 > 

RIKEN DNA Bank Human Resource - CRX

Gene ID NCBI Gene 1406 |  KEGG hsa:1406
Gene Symbol CRX
Protein Name cone-rod homeobox
Synonyms CORD2|CRD|LCA7|OTX3
Ortholog resource in our bank

  CRX

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005453 IRAK013K13 pCMV-SPORT6 BC009045 NM_000554 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR325232 RBb13B08 pKA1U5 NM_000554.4  
TGGTTCCTTCAGCCTCTGCTGTCTGGCCGCTCTGTCTAGGTCCTGGGCCACGGGAGAGCC
HKR326500 RBb16E04 pKA1U5 NM_000554.4  
GCTAGGTCCTGGGCCACGGGAGAGCCCCGTCCCTCCTTTCTGAAGGCCCCCTGACTTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl