Prev. |  KEGG KO K05423 > 

RIKEN DNA Bank Human Resource - CRMP1

Gene ID NCBI Gene 1400 |  KEGG hsa:1400
Gene Symbol CRMP1
Protein Name collapsin response mediator protein 1
Synonyms CRMP-1|DPYSL1|DRP-1|DRP1|ULIP-3
Ortholog resources KEGG ortholog (KEGG orthology K05423) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04081 pAxCALNLhCSF3/G-CSF (reverse) Shuttle vector to generate rAd harboring human CSF3/G-CSF (reverse)
RDB04171 pAxCALNLhCSF3/G-CSF (reverse) Shuttle vector to generate rAd harboring human CSF3/G-CSF
RDB03497 pAxCALNLhCSF3/G-CSF (forward) Shuttle vector to generate rAd harboring human CSF3/G-CSF (forward)
RDB03605 pAxCALNLhCSF3/G-CSF (forward) Shuttle vector to generate rAd harboring human CSF3/G-CSF (forward)

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082460 IRAL006C12 pOTB7 BC000252 NM_001313 Full
HGY088187 IRAL020H19 pOTB7 BC007898 NM_001313 Partial
HGY089176 IRAL022P16 pOTB7 BC007613 NM_001313 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR323651 RBb09C03 pKA1U5 NM_001313.3  
GGCAGTCGCGCCCGGGCCGCCGCAGGCCCGCACCGANGCGCGGAGCGCGGCGCACGGCGG
HKR332154 RBb30G10 pGCAP1 NM_001313.3  
GAGGCCCGCACCGAGGCGCGGAGCGCGGCGCACGGCGGCTGCCNAGGGCCGCGGGCGGGC
HKR380100 RBd50E04 pGCAP10 NM_001313.3  
TTGTCTCTCCCCGGGCCCCCNCAGGCCCGCACCGAGGCGCGNTTGCGGCTCCGGCGTNGC
HKR406148 RBdS015G04 pGCAP10 NM_001313.3  
GGCAGTCGCGCCCGGGCCGCCGCAGGCCCGCACCGAGGCGCGGAGCGCGGCGCACGGCGG
HKR409128 RBdS022N16 pGCAP10 NM_001313.3  
GNGTCGNGCCCGGGCCGCCGCANGCCCACACCGAGGCGCGGAGCGCGGCGCACGGCGGTG
HKR442205 RBdS105I13 pGCAP10 NM_001313.3  
GAGTCGCGCCCGGGCCGCCGCAGGCCCGCACCGAGGCGCGGAGCGCGGCGCACGGCGGTG
HKR461906 RBdS154M18 pGCAP10 NM_001313.3  
GCCGCACCGAGGCGCGGAGCGCGGCGCACGGCGGTGCCCAGGGCCGCGGGCGGGCAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl