Prev. |  KEGG KO K04438 > 

RIKEN DNA Bank Human Resource - CRKL

Gene ID NCBI Gene 1399 |  KEGG hsa:1399
Gene Symbol CRKL
Protein Name CRK like proto-oncogene, adaptor protein
Synonyms -
Ortholog resource in our bank

  CRKL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011841 IRAK029K01 pCMV-SPORT6 BC033281 NM_005207 Partial/var
HGX035898 IRAK089M10 pCMV-SPORT6 BC043500 NM_005207 Full
HGY042670 IRAK106L06 pBluescript BC044621 NM_005207 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366079 RBd15D07 pGCAP10 NM_005207.2  
GCTTCTCCCGCGTCCGCCATTTTGTTGCTGTGGCTATTGGGAACAAGCTGGGCAAAAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl