Prev. |  KEGG KO K04438 > 

RIKEN DNA Bank Human Resource - CRK

Gene ID NCBI Gene 1398 |  KEGG hsa:1398
Gene Symbol CRK
Protein Name CRK proto-oncogene, adaptor protein
Synonyms CRKII|p38
Ortholog resource in our bank

  CRK

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001609 IRAK004A09 pCMV-SPORT6 BC008506 NM_016823 Full
HGY082569 IRAL006H01 pOTB7 BC001718 NM_016823 Full
HGY090313 IRAL025N01 pOTB7 BC009837 NM_005206 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001301 W01A003E05 pENTR-TOPO IRAK004A09 BC008506 NM_016823  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR082032 ARf05B08 pKA1U5 NM_005206.3  
GGTGAAGCTGAAACCGGAGCCGGTCCGCTGGGCGGCGGGCGCCGGGGGCCGGAGGGGCGC
HKR234006 ARiS085A06 pGCAP10 NM_005206.3  
GATTTCCGGAGGGGGAGGCCCGCGGCTGCCGCCGCCATTTCGGGCGCTGCTGTGAAGCTG
HKR234165 ARiS085G21 pGCAP10 NM_005206.3  
GGCCGCCGCCATTTCGGGCGCTGCTGTGAAGCTGAAACCGGAGCCGGTCCGCTGGGCGGC
HKR367706 RBd19E10 pGCAP10 NM_005206.3  
CGGCCGGCCGATGGAGGCCCGCGGCTGCCGCCGCCATTTCGGGCGCTGCTGTGAAGCTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl