RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - CREM

Gene ID	NCBI Gene 1390 \| KEGG hsa:1390
Gene Symbol	CREM
Protein Name	cAMP responsive element modulator
Synonyms	CREM-2\|ICER\|hCREM-2

Ortholog resource in our bank

  CREM

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB07811	pGL4-phCREM	Promoter collection, Human CREM promoter

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR389257	RBd73C09	pGCAP10	NM_001881.2	Full
HKR389257	CGGCCGGCCGATGAGGACGGGGCGGGAGGACGCGGTTCGGTCGGCTGCAGCGCTACTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.11.09

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl