Prev. |  KEGG KO K09052 > 

RIKEN DNA Bank Human Resource - CREM

Gene ID NCBI Gene 1390 |  KEGG hsa:1390
Gene Symbol CREM
Protein Name cAMP responsive element modulator
Synonyms CREM-2|ICER|hCREM-2
Ortholog resource in our bank

  CREM

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07811 pGL4-phCREM Promoter collection, Human CREM promoter

webcatalog20210331.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR389257 RBd73C09 pGCAP10 NM_001881.2 done
CGGCCGGCCGATGAGGACGGGGCGGGAGGACGCGGTTCGGTCGGCTGCAGCGCTACTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl