RIKEN DNA Bank Human Resource - ATF2
|
Ortholog resource in our bank ATF2 External database KEGG gene KEGG Ortholog NCBI Gene |
Individualy Deposited Resource
| Catalog number | Name of Resource | Description |
|---|---|---|
| RDB05426 | pAxCALNLhATF2 (forward) | Shuttle vector to generate rAd harboring human ATF2 (forward) |
| RDB05427 | pAxCALNLhATF2 (reverse) | Shuttle vector to generate rAd harboring human ATF2 (reverse) |
| RDB06038 | pcDNA3 FLAG hATF2 WT | Expression vector of FLAG-tagged human ATF2 WT |
| RDB06039 | pcDNA3 FLAG hATF2 S121A | Expression vector of FLAG-tagged human ATF2 S121A |
| RDB06043 | pET-15b His hATF2 WT | Expression vector of His-tagged human ATF2 WT |
| RDB06044 | pET-15b His hATF2 S121A | Expression vector of His-tagged human ATF2 S121A |
| RDB06049 | pcDNA3 FLAG hATF2 wt HA | Expression vector of FLAG-tagged human ATF2 wt HA |
| RDB06058 | pET-15b His hATF2 DN T69A T71A | Expression vector of His-tagged human ATF2 DN T69A T71A |
| RDB06060 | pcDNA3 hATF2 wt HA | Expression vector of human ATF2 wt HA |
| RDB06061 | pGEX-ATF2 | Expression vector of GST-tagged human ATF2 |
| RDB06257 | pCMFlag_hsATF2 | Expression vector of human ATF2. |
| RDB06321 | pET_HisFLAG-hsATF-2 | Expression vector of human ATF-2 tagged with His- and FLAG- epitope |
| RDB07428 | pAxEFFlag_humanATF2wt_HAit2 | Shuttle vector to generate rAd harboring human ATF2 |
| RDB07429 | pAxEFFlag_humanATF2wtit2 | Shuttle vector to generate rAd harboring human ATF2 |
| RDB07430 | pAxEF_humanATF2wtit2 | Shuttle vector to generate rAd harboring human ATF2 |
| RDB07432 | pAxEFFlag_humanATF2 S121Ait2 | Shuttle vector to generate rAd harboring human ATF2 |
| RDB07433 | pAxEFFlag_humanATF2 K296.G297.G299Ait2 | Shuttle vector to generate rAd harboring human ATF2 |
| RDB07437 | pdxEFFlag_humanATF2wt_HAit2 | Plasmid clone of human ATF2 cDNA |
| RDB07438 | pdxEFFlag_humanATF2wtit2 | Plasmid clone of human ATF2 cDNA |
| RDB07439 | pdxEF_humanATF2wtit2 | Plasmid clone of human ATF2 cDNA |
| RDB07441 | pdxEFFlag_humanATF2 S121Ait2 | Plasmid clone of human ATF2 cDNA |
| RDB07442 | pdxEFFlag_humanATF2 K296.G297.G299Ait2 | Plasmid clone of human ATF2 cDNA |
| RDB07712 | pGL4-phATF2 | Promoter collection, Human ATF2 promoter |
webcatalog20220516.tab
NRCD Human cDNA Clone
Plasmid request [in Japanese] [in English]
| Catalog number | Clone name | Vector | CDS comparison | Status | |
|---|---|---|---|---|---|
| Refered mRNA(1) | CDS status | ||||
| 5'-terminal sequence(2) | |||||
| HKR054812 | ARe37A12 | pKA1U5 | NM_001880.2 | No cds |  |
| GAGTCCGATCTCGCGAGAGAGGACGGAAGCCTGCTGGGAGCCCGTGGCCTTTAAAGTGCC | |||||
♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.
NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv
2023.11.09
Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl