Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATF2

Gene ID (NCBI) 1386
Gene Symbol ATF2
Protein Name activating transcription factor 2
Synonyms CRE-BP1|CREB2|HB16|TREB7
Databases KEGG link 01 |  NCBI Gene link 01
Featured content MAPK p38 inhibitor screening


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05426 pAxCALNLhATF2 (forward) Shuttle vector to generate rAd harboring human ATF2 (forward)
RDB05427 pAxCALNLhATF2 (reverse) Shuttle vector to generate rAd harboring human ATF2 (reverse)
RDB06038 pcDNA3 FLAG hATF2 WT Expression vector of FLAG-tagged human ATF2 WT
RDB06039 pcDNA3 FLAG hATF2 S121A Expression vector of FLAG-tagged human ATF2 S121A
RDB06043 pET-15b His hATF2 WT Expression vector of His-tagged human ATF2 WT
RDB06044 pET-15b His hATF2 S121A Expression vector of His-tagged human ATF2 S121A
RDB06049 pcDNA3 FLAG hATF2 wt HA Expression vector of FLAG-tagged human ATF2 wt HA
RDB06058 pET-15b His hATF2 DN T69A T71A Expression vector of His-tagged human ATF2 DN T69A T71A
RDB06060 pcDNA3 hATF2 wt HA Expression vector of human ATF2 wt HA
RDB06061 pGEX-ATF2 Expression vector of GST-tagged human ATF2
RDB06257 pCMFlag_hsATF2 Expression vector of human ATF2
RDB06321 pET_HisFLAG-hsATF-2 Expression vector of human ATF-2 tagged with His- and FLAG- epitope
RDB07428 pAxEFFlag_humanATF2wt_HAit2 Shuttle vector to generate rAd harboring human ATF2
RDB07429 pAxEFFlag_humanATF2wtit2 Shuttle vector to generate rAd harboring human ATF2
RDB07430 pAxEF_humanATF2wtit2 Shuttle vector to generate rAd harboring human ATF2
RDB07432 pAxEFFlag_humanATF2 S121Ait2 Shuttle vector to generate rAd harboring human ATF2
RDB07433 pAxEFFlag_humanATF2 K296.G297.G299Ait2 Shuttle vector to generate rAd harboring human ATF2
RDB07437 pdxEFFlag_humanATF2wt_HAit2 Plasmid clone of human ATF2 cDNA
RDB07438 pdxEFFlag_humanATF2wtit2 Plasmid clone of human ATF2 cDNA
RDB07439 pdxEF_humanATF2wtit2 Plasmid clone of human ATF2 cDNA
RDB07441 pdxEFFlag_humanATF2 S121Ait2 Plasmid clone of human ATF2 cDNA
RDB07442 pdxEFFlag_humanATF2 K296.G297.G299Ait2 Plasmid clone of human ATF2 cDNA
RDB07712 pGL4-phATF2 Promoter collection, Human ATF2 promoter

RDB_hum_161122.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054812 ARe37A12 pKA1U5 NM_001880.2  
GAGTCCGATCTCGCGAGAGAGGACGGAAGCCTGCTGGGAGCCCGTGGCCTTTAAAGTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.01.23

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl